ID: 1036549661

View in Genome Browser
Species Human (GRCh38)
Location 8:9805213-9805235
Sequence GATGCCAAAAGCCTGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549655_1036549661 16 Left 1036549655 8:9805174-9805196 CCGGGGCTCCTTCAAAACTTCCT No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data
1036549653_1036549661 25 Left 1036549653 8:9805165-9805187 CCACAGCTCCCGGGGCTCCTTCA No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data
1036549654_1036549661 17 Left 1036549654 8:9805173-9805195 CCCGGGGCTCCTTCAAAACTTCC No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data
1036549657_1036549661 8 Left 1036549657 8:9805182-9805204 CCTTCAAAACTTCCTCGTGGACC No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data
1036549658_1036549661 -4 Left 1036549658 8:9805194-9805216 CCTCGTGGACCTTGCTTCAGATG No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data
1036549652_1036549661 30 Left 1036549652 8:9805160-9805182 CCAAGCCACAGCTCCCGGGGCTC No data
Right 1036549661 8:9805213-9805235 GATGCCAAAAGCCTGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549661 Original CRISPR GATGCCAAAAGCCTGGCCAC TGG Intergenic
No off target data available for this crispr