ID: 1036549662

View in Genome Browser
Species Human (GRCh38)
Location 8:9805214-9805236
Sequence ATGCCAAAAGCCTGGCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 19, 1: 12, 2: 6, 3: 34, 4: 363}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549653_1036549662 26 Left 1036549653 8:9805165-9805187 CCACAGCTCCCGGGGCTCCTTCA No data
Right 1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG 0: 19
1: 12
2: 6
3: 34
4: 363
1036549655_1036549662 17 Left 1036549655 8:9805174-9805196 CCGGGGCTCCTTCAAAACTTCCT No data
Right 1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG 0: 19
1: 12
2: 6
3: 34
4: 363
1036549654_1036549662 18 Left 1036549654 8:9805173-9805195 CCCGGGGCTCCTTCAAAACTTCC No data
Right 1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG 0: 19
1: 12
2: 6
3: 34
4: 363
1036549658_1036549662 -3 Left 1036549658 8:9805194-9805216 CCTCGTGGACCTTGCTTCAGATG No data
Right 1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG 0: 19
1: 12
2: 6
3: 34
4: 363
1036549657_1036549662 9 Left 1036549657 8:9805182-9805204 CCTTCAAAACTTCCTCGTGGACC No data
Right 1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG 0: 19
1: 12
2: 6
3: 34
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549662 Original CRISPR ATGCCAAAAGCCTGGCCACT GGG Intergenic
900417474 1:2541767-2541789 AGGACAGAAGCCTGGCCACGTGG + Intergenic
900722532 1:4186666-4186688 GTGCCAGAAACCTAGCCACTGGG - Intergenic
901033477 1:6322129-6322151 TTCCCAAAAGCCTTGGCACTTGG + Intronic
902617719 1:17632946-17632968 ATGCCCAAAGCCCGGCTGCTGGG + Intronic
904116989 1:28170185-28170207 ATGCCAGAAGCCTTGGCCCTTGG - Intronic
904376109 1:30083576-30083598 AAGGCACAAGCCTGGCCTCTGGG + Intergenic
904399439 1:30246515-30246537 AGGCCAAGACCCTGGCGACTCGG + Intergenic
905489393 1:38331844-38331866 ATGTCCAGAGTCTGGCCACTGGG + Intergenic
905936255 1:41826628-41826650 ATGCCAAAAGCCTGGCCACTGGG - Intronic
906049575 1:42859160-42859182 ACGCCAAAAGCCCGGCCACTGGG + Intergenic
907293612 1:53434523-53434545 GTGCCAGAAATCTGGCCACTGGG + Intergenic
907521268 1:55024877-55024899 GTGCCAGAAATCTGGCCACTGGG + Intergenic
909035483 1:70590581-70590603 GTGCCAGAAATCTGGCCACTGGG + Intergenic
909374171 1:74921193-74921215 GTGCCAGAAATCTGGCCACTGGG + Intergenic
909909969 1:81247716-81247738 ATGCCGGAAATCTGGCCACTGGG + Intergenic
911147978 1:94570292-94570314 GTGCCAGAAATCTGGCCACTGGG - Intergenic
911153459 1:94617556-94617578 ATGCCTAATGCCTAACCACTTGG - Intergenic
911510607 1:98804674-98804696 GTGCCAGAAATCTGGCCACTGGG - Intergenic
913038754 1:115002465-115002487 ATGTCAAAAGCATGCCCACTTGG - Intergenic
913095770 1:115514004-115514026 AATGCCAAAGCCTGGCCACTGGG - Intergenic
915007033 1:152647880-152647902 ATCCCAAGAACCTGGTCACTGGG - Intergenic
915830502 1:159125050-159125072 ATGCCAATAGCCTGTTCCCTGGG - Intronic
916195509 1:162218679-162218701 ATAGCAAAAGCCTGGACTCTGGG - Intronic
916941799 1:169685144-169685166 GTGCCAGAAATCTGGCCACTGGG + Intronic
917222341 1:172745399-172745421 ATCCCAAAAGCCTGCACAGTAGG + Intergenic
917359950 1:174164184-174164206 ATGCTAAAAACCTTGGCACTTGG + Intronic
919226477 1:194710295-194710317 TTGCTAACAGCCTAGCCACTTGG - Intergenic
920959822 1:210654428-210654450 ATGCCAAGAGCCAGGGCACATGG - Intronic
921108762 1:212012030-212012052 TTGCCAAAAACCTGAGCACTGGG + Intronic
921987946 1:221333015-221333037 ATGCAAACAGCCTTTCCACTTGG + Intergenic
922049524 1:221976540-221976562 ATGCCGGAAATCTGGCCACTGGG - Intergenic
922154058 1:223027840-223027862 ATGCCGGAAATCTGGCCACTGGG - Intergenic
922308449 1:224365335-224365357 ATGCCAGAATCCTGGCCTATCGG - Intronic
922368508 1:224887719-224887741 ATGCCAAAAGTCTGGCCACTGGG + Intergenic
922603483 1:226874224-226874246 GTGACCAAACCCTGGCCACTGGG + Intronic
922845408 1:228680374-228680396 ATGCCAAAAGCCTGGCCACTGGG - Intergenic
922877092 1:228948512-228948534 GTGCCAAAAATCTGGCCACCGGG + Intergenic
923257265 1:232232638-232232660 GTGCCAGAAATCTGGCCACTGGG - Intergenic
923688302 1:236169552-236169574 ATGCCAAAAACATGGACACCGGG + Intronic
923698616 1:236279645-236279667 ATGGCAAAACCCTGTCTACTGGG + Intronic
923962794 1:239103647-239103669 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1062903078 10:1160304-1160326 AGGCCAAAACCCTTGCCATTTGG + Intergenic
1063197549 10:3757833-3757855 ATGGCAACAGCATGGCCTCTAGG - Intergenic
1063852971 10:10213889-10213911 ATGCCAGAAGCTTTGCCAGTAGG - Intergenic
1064295723 10:14077362-14077384 TTGCCAAAAGCCTGACTTCTTGG + Intronic
1065328029 10:24567839-24567861 ATGCCCCAAGCCTGCCCTCTGGG + Intergenic
1065443110 10:25772174-25772196 ATGCCGGAAATCTGGCCACTGGG - Intergenic
1065610593 10:27467731-27467753 ATGCCAAAAGCCTGGCCACTGGG + Intergenic
1067507742 10:46871119-46871141 AGCCCAACAGCCTGGCCCCTAGG + Intergenic
1067654511 10:48180726-48180748 AGCCCAACAGCCTGGCCCCTAGG - Intronic
1068058340 10:52037199-52037221 GTGCCAGAAATCTGGCCACTGGG - Intronic
1068360782 10:55973477-55973499 GTGCCAGAAATCTGGCCACTAGG + Intergenic
1068601363 10:58960501-58960523 ACCACAAAAGCATGGCCACTAGG - Intergenic
1069301032 10:66908116-66908138 ATGCCACATGCCAGGCTACTTGG + Intronic
1070474935 10:76820846-76820868 ATGCCAGAAATCTGGCCACTGGG + Intergenic
1070707386 10:78650366-78650388 ATGACAATAGCCTGGCCTCTAGG - Intergenic
1071008596 10:80911804-80911826 ATAACAAAACCCTGACCACTTGG + Intergenic
1071821745 10:89286972-89286994 GTGCCAGAAATCTGGCCACTGGG + Intronic
1071897724 10:90084475-90084497 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1071916211 10:90297282-90297304 ATGCCAGAAATCTGGCCACTGGG + Intergenic
1072011267 10:91304922-91304944 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1073394626 10:103207842-103207864 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1075595076 10:123723330-123723352 ATGACCCAGGCCTGGCCACTTGG + Intronic
1077933144 11:6754294-6754316 ATCCCAAAAGACTCACCACTAGG - Intergenic
1078046116 11:7915596-7915618 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1079230523 11:18645306-18645328 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1080388184 11:31822593-31822615 ATGCCCAAACCCTTGGCACTGGG - Intronic
1080994440 11:37582055-37582077 GTGCCGAAAATCTGGCCACTGGG - Intergenic
1081159712 11:39736682-39736704 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1081356815 11:42122852-42122874 ATGCCGGAAATCTGGCCACTGGG + Intergenic
1082960611 11:58915541-58915563 ATTCTCAAAGCCTGGCCCCTGGG + Intronic
1083445856 11:62707632-62707654 ATACCAACTGCCTGGCCAGTGGG - Intronic
1084354200 11:68626419-68626441 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1085988024 11:81808491-81808513 GTGCCAAAAATCTGGCCACCAGG + Intergenic
1086005029 11:82027497-82027519 GTGCCAAAAATCTGGCCACTGGG + Intergenic
1086125300 11:83343519-83343541 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1086133159 11:83421400-83421422 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1086276085 11:85130777-85130799 ATCCCAAGTGCATGGCCACTTGG + Intronic
1086658067 11:89383259-89383281 GTGCCAGAAATCTGGCCACTGGG + Intronic
1087099109 11:94347996-94348018 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1087839532 11:102907514-102907536 GTGCCAGAAATCTGGCCACTAGG - Intergenic
1088814770 11:113413388-113413410 GTGCCAAAAGGCTGACCCCTGGG + Intronic
1089491165 11:118885207-118885229 CTACCCAAAGCCTGGCCCCTCGG + Intronic
1089867039 11:121641359-121641381 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1089953307 11:122549228-122549250 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1090284773 11:125490481-125490503 ATTCCAAATGCCTGGCCCCAGGG + Intronic
1092572972 12:9745423-9745445 ATTCCAAAAGCCTGGCTCCCAGG + Intergenic
1093024341 12:14232856-14232878 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1093302239 12:17471826-17471848 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1093951080 12:25165424-25165446 GTGCCAGAAATCTGGCCACTGGG + Intronic
1094316042 12:29138437-29138459 ATGCCAGAAATCTGGCCACTGGG - Intergenic
1094825764 12:34267914-34267936 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1095778146 12:46032135-46032157 ATGCCAAAAGCCTGGCCAGTGGG + Intergenic
1097315206 12:58164481-58164503 ATGACAAGGGCCTGGCTACTTGG + Intergenic
1097592431 12:61589528-61589550 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1098173630 12:67770083-67770105 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1098630024 12:72712329-72712351 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1098653817 12:73005399-73005421 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1098919914 12:76293736-76293758 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1099565146 12:84233007-84233029 TTGACATAAGCCTGGCCACATGG + Intergenic
1099872794 12:88369951-88369973 ATGCCAAAAGCATAGCCACTAGG + Intergenic
1101523202 12:105503991-105504013 AGGACAAAAACCTGGCCAGTGGG - Intergenic
1102604479 12:114058115-114058137 ATGCCAAAAGCCCGGCCACTGGG + Intergenic
1102993372 12:117330527-117330549 ATGCCAACGGCCTGGCCCCCAGG - Exonic
1104257612 12:127154069-127154091 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1105675976 13:22672024-22672046 ATCCCCCTAGCCTGGCCACTAGG - Intergenic
1106655538 13:31742296-31742318 ATGCCTTGAGTCTGGCCACTAGG - Intronic
1108282055 13:48870558-48870580 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1108513003 13:51172144-51172166 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1108919538 13:55658409-55658431 ATGCCAGAAATCTGGCCACTGGG - Intergenic
1108952938 13:56115853-56115875 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1110650477 13:77936755-77936777 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1110845351 13:80185949-80185971 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1111362098 13:87189862-87189884 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1111630450 13:90841717-90841739 ATGCCGGAAATCTGGCCACTGGG + Intergenic
1112300187 13:98222995-98223017 TTGCCAAAACCCTGGTCACTGGG - Intronic
1112821664 13:103345243-103345265 ATGCCCAAAAACTGGCCCCTTGG - Intergenic
1112889308 13:104211492-104211514 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1113886642 13:113664299-113664321 ATGCCAATATCCTCGCTACTTGG + Intergenic
1115060595 14:29184514-29184536 AGGCCAAAAGCTAGGCCTCTTGG - Intergenic
1118918301 14:70126990-70127012 ATGACCAATTCCTGGCCACTGGG + Intronic
1118937248 14:70299237-70299259 GTGCCAGAAATCTGGCCACTAGG - Intergenic
1119022441 14:71126603-71126625 GTGCCAGAAATCTGGCCACTAGG + Intergenic
1119248333 14:73131756-73131778 ATGCCAAAAGCCTGGCCACTGGG - Intergenic
1119560276 14:75584112-75584134 ATGCCAGAAGCCTGGCCACTGGG - Intronic
1120618265 14:86733626-86733648 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1123882484 15:24689014-24689036 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1125062223 15:35438011-35438033 AAGCCAAAATACTGGCCACTTGG + Intronic
1126228521 15:46298600-46298622 AAGTCAAAACTCTGGCCACTGGG + Intergenic
1129065780 15:72902799-72902821 AGGCGAAATGCCTGGCCAATCGG - Intergenic
1129111724 15:73340913-73340935 AGGCCAAAAGCCCTACCACTGGG + Intronic
1129810618 15:78507282-78507304 GAGCCGAAAGCCTGCCCACTCGG + Intergenic
1130304559 15:82704529-82704551 GTGCCAGAAATCTGGCCACTGGG + Intronic
1131882507 15:96875259-96875281 ATGCCGGAAATCTGGCCACTGGG - Intergenic
1132339379 15:101068486-101068508 AAGCCCACAGGCTGGCCACTGGG + Intronic
1132410203 15:101571853-101571875 ATGCTAAAAGCTTGGCCACTGGG - Intergenic
1133592147 16:7256249-7256271 CTCCCAAAAGCCAGGCCTCTGGG + Intronic
1134342171 16:13356003-13356025 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1136529960 16:30861434-30861456 GTGCCAGAAATCTGGCCACTGGG + Intronic
1138469625 16:57223319-57223341 ATTTTAAAAGGCTGGCCACTGGG + Intronic
1139161837 16:64519571-64519593 ATGCCAAGAGACTGGCCCCATGG - Intergenic
1141279198 16:82615282-82615304 AGGCCTAGAGCCTGGCCACATGG - Intergenic
1141666198 16:85466557-85466579 ATGCCAAAGGCATGGCCACCTGG - Intergenic
1143329927 17:6126308-6126330 GTGACAAGAGCCTGGTCACTTGG + Intergenic
1143414338 17:6735037-6735059 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1144033336 17:11341718-11341740 ATGCCAACAGCCTGGCTGCAGGG + Intronic
1146298744 17:31671917-31671939 GGGCCAAAAGCCTGGACTCTGGG + Intergenic
1148475089 17:47923286-47923308 CTGCCAACACCCTGGCCACAGGG - Intronic
1150130212 17:62665022-62665044 AGGCCAAAGGCCTTGTCACTGGG - Intronic
1151405368 17:73882590-73882612 CTGCCACCAGCCTGGGCACTTGG + Intergenic
1152453964 17:80402181-80402203 ATGCCAAAAGCCTGGCCACTGGG + Intergenic
1152762347 17:82115351-82115373 ATGAGAAAAGCCTGGCTACAAGG + Intronic
1153574509 18:6507236-6507258 ATGTCAAAAGCATGCCCACTTGG + Intergenic
1153952051 18:10065814-10065836 ATCCCAACAGCCTGCCCCCTTGG - Intergenic
1155613335 18:27693849-27693871 ATGCCAAAAGATTGGACACAGGG + Intergenic
1155892687 18:31287667-31287689 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1155941557 18:31806083-31806105 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1156251922 18:35359740-35359762 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1156915821 18:42463847-42463869 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1156924044 18:42555922-42555944 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1156958188 18:42993152-42993174 GTGCCAGAAATCTGGCCACTGGG + Intronic
1157906382 18:51573470-51573492 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1158875870 18:61734058-61734080 AAGTGAAAAGCCTGGCCTCTTGG + Intergenic
1160568499 18:79800964-79800986 CTGCCAACAGTCTGGCCACGAGG + Intergenic
1161408516 19:4103345-4103367 ATGCCAAAACCCCAGGCACTGGG + Intronic
1162286679 19:9744101-9744123 ATGCCAAAAGCCTGGTCACTGGG + Intergenic
1163572295 19:18089763-18089785 ATTGCACAACCCTGGCCACTTGG - Intronic
1163900215 19:20094056-20094078 GTGCCAGAAATCTGGCCACTGGG - Intronic
1163944444 19:20522512-20522534 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1164080816 19:21860080-21860102 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1164923269 19:32105719-32105741 AATCCAACAGCCTGGCCTCTGGG + Intergenic
1166303969 19:41927570-41927592 AAGCCAAGAGACTGGACACTTGG - Intronic
1167099465 19:47395325-47395347 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1167901108 19:52623027-52623049 GTGCCAGAAATCTGGCCACTGGG + Intronic
1167902158 19:52630050-52630072 GTGCCAGAAATCTGGCCACTGGG + Intronic
1168248149 19:55124819-55124841 GTGCCAGAAATCTGGCCACTGGG + Intergenic
925828812 2:7876093-7876115 GTGCCAGAAATCTGGCCACTGGG - Intergenic
926413597 2:12628780-12628802 ATGCCAGAAATCTGGCCACTGGG + Intergenic
926464084 2:13167422-13167444 ATGCCGCAAATCTGGCCACTGGG - Intergenic
927134167 2:20084594-20084616 GTGCCAGAAATCTGGCCACTGGG + Intergenic
927174815 2:20398468-20398490 GTGCCGAAAGCGTGGCTACTGGG - Intergenic
928261406 2:29770238-29770260 TTGCCAGAATCATGGCCACTAGG + Intronic
928430608 2:31215435-31215457 ACACCAAGAGCCTGGCCATTTGG - Intronic
928827648 2:35440529-35440551 GTGCCAGAAGTCTGGCCACCAGG - Intergenic
928857177 2:35815359-35815381 GTGCCAGAAGTCTGGCCACCAGG + Intergenic
929493933 2:42423039-42423061 ATTCCAAAATCCTGACCATTTGG + Intronic
929802749 2:45118049-45118071 ATGACAGAAGCCTGGTCATTTGG + Intergenic
931608916 2:64078601-64078623 GTGCCAGAAATCTGGCCACTGGG - Intergenic
932367638 2:71163115-71163137 ATGCCGGAAATCTGGCCACTGGG - Intergenic
932439712 2:71726163-71726185 AAGCCAAAAGCCTTCTCACTGGG + Intergenic
932862433 2:75308190-75308212 AGGCCAAAAGCTAGGCCTCTTGG + Intergenic
934578625 2:95419975-95419997 AGCCCAAAGGCCTGACCACTAGG + Intergenic
934600816 2:95656734-95656756 AGTCCAAAGGCCTGACCACTAGG - Intergenic
935397377 2:102622200-102622222 ATGCCACAAGCCTGCCCTGTAGG + Intronic
936719806 2:115237589-115237611 AGGCCAAAAGCTAGGCCTCTTGG + Intronic
937093265 2:119220635-119220657 TAGCCAGAAGCCAGGCCACTTGG - Intergenic
939083130 2:137686375-137686397 GTGCCAGAAATCTGGCCACTGGG - Intergenic
939548190 2:143580089-143580111 ATGCCATAAGCCTGGTCTGTTGG - Intronic
939801869 2:146720692-146720714 CTGCCAGAAGCCTGGGGACTGGG + Intergenic
940182948 2:150955318-150955340 GTGCCAAAAATCTGGCCACTGGG + Intergenic
940183689 2:150960586-150960608 AATGCCAAAGCCTGGCCACTGGG + Intergenic
941353393 2:164461389-164461411 ATGCCGGAAATCTGGCCACTGGG + Intergenic
943061579 2:183046165-183046187 GTGCCAGAAATCTGGCCACTGGG + Intergenic
943566517 2:189523222-189523244 AAGCCAAAAGAATGGCCACTGGG - Intergenic
944603145 2:201323583-201323605 ATGCTACCAGCCTGGCCACATGG + Intronic
945394310 2:209301502-209301524 ATGCCGGAAATCTGGCCACTGGG + Intergenic
945554695 2:211263747-211263769 GTGCCAGAAATCTGGCCACTGGG + Intergenic
947796640 2:232897233-232897255 ATGCCAAAGCCCTGGGCCCTGGG - Intronic
948996029 2:241579476-241579498 ATGCAGAACGCCTGGCCCCTTGG + Intergenic
1168943271 20:1731174-1731196 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1169928497 20:10807678-10807700 CTGCCAAAACCATGGCCACATGG + Intergenic
1169928638 20:10808551-10808573 CTGCCAAAACCATGGCCACATGG - Intergenic
1170068858 20:12343707-12343729 ATGCCAGAAATCTGGCCATTGGG - Intergenic
1170106241 20:12756151-12756173 ATGCCAGAAATCTGGCCATTGGG + Intergenic
1171192509 20:23169123-23169145 CTGACACAAACCTGGCCACTAGG + Intergenic
1172891811 20:38271118-38271140 AAGCCAAAAGCCAGGGCTCTGGG + Intronic
1173101921 20:40095627-40095649 ATGCCGGAAATCTGGCCACTGGG + Intergenic
1173652039 20:44672635-44672657 ATGCTAAAAGCCTGGCCACTGGG + Intergenic
1173781732 20:45762072-45762094 GTGCCAGAAATCTGGCCACTGGG + Intronic
1177031164 21:15983223-15983245 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1178001208 21:28163493-28163515 GTGCCAGAAATCTGGCCACTAGG + Intergenic
1178618297 21:34153052-34153074 TTTCCAAAAGCCTGGCCTCCTGG + Intergenic
1178623838 21:34199341-34199363 ATGCCAAGAGCCAGGCGCCTGGG - Intergenic
1179387565 21:40957229-40957251 ATGCCAGAAATCTGGCCACTGGG + Intergenic
1179708546 21:43196226-43196248 TAGCCAAAGGCCTGGCTACTTGG + Intergenic
1180560951 22:16613908-16613930 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1181875209 22:25935358-25935380 ATGCCTAAGGCATGACCACTCGG - Intronic
1182017921 22:27056319-27056341 GTGGGAAAACCCTGGCCACTGGG + Intergenic
1182113958 22:27744262-27744284 ATGCCGGAAATCTGGCCACTGGG + Intergenic
1183635663 22:39060947-39060969 GTGCCAGAAATCTGGCCACTGGG - Intronic
1183860737 22:40668114-40668136 ATGCCCAAACCCTGGCAAATAGG + Intergenic
1184451675 22:44586253-44586275 CTCCCAACAGCCTGGCCTCTGGG + Intergenic
1185068458 22:48643581-48643603 ATGCCAAAGCCCTGGCCGGTCGG + Intronic
949773310 3:7602559-7602581 ATGCTGAAAGCCTGGGCACAGGG - Intronic
951762787 3:26163801-26163823 GTGCCAGAAATCTGGCCACTGGG - Intergenic
952296880 3:32069876-32069898 ATGCCAAAAGCCTGGCCACTGGG + Intronic
952895208 3:38074095-38074117 GTGCCAGAAATCTGGCCACTAGG - Intronic
953656559 3:44859115-44859137 GTGCCATAAATCTGGCCACTGGG - Intronic
954161760 3:48727760-48727782 ATGCCAGAAATCTGGCCACTGGG - Intronic
954663161 3:52236870-52236892 AGGCCCCAAGCCTGGCCTCTGGG + Intronic
954969259 3:54637914-54637936 ATGCCGGAAATCTGGCCACTGGG - Intronic
955253373 3:57305957-57305979 GTGCCAGAAATCTGGCCACTGGG + Intronic
955290363 3:57686960-57686982 AGGCCAAAAGCTAGGCCTCTTGG + Intronic
955416592 3:58697682-58697704 AGGCCAAAAGCTAGGCCTCTTGG - Intergenic
955593554 3:60563512-60563534 AGGCCAAAAGCTAGGCCTCTTGG + Intronic
955797011 3:62647957-62647979 TTGCCCAAGGCCTGGCTACTGGG + Intronic
956320677 3:67992953-67992975 ATGACTCAAGCCTGACCACTCGG - Intergenic
956894404 3:73645081-73645103 AGGCCAAAAGCCTGAATACTGGG + Intergenic
957155108 3:76536083-76536105 ATGCCACAAAACTGGCCACTGGG - Intronic
957317304 3:78586578-78586600 ATGCCGGAAATCTGGCCACTGGG - Intergenic
957394373 3:79620092-79620114 GTGCCAGAAATCTGGCCACTGGG + Intronic
957985695 3:87571635-87571657 GTGCCAGAAATCTGGCCACTGGG + Intergenic
958755538 3:98246261-98246283 ATGCCAAAATCCTGGCCACTGGG + Intergenic
961191393 3:124965188-124965210 ATGGCAAAAACCTTGGCACTGGG - Intergenic
961326492 3:126112307-126112329 GGGCCCACAGCCTGGCCACTTGG + Intronic
961712712 3:128839614-128839636 ATGCCAAAAGCCTGGCCACTGGG - Intergenic
962523960 3:136221309-136221331 ATGCCAAAAGCCTGGCCACTGGG - Intergenic
964067880 3:152599618-152599640 GTGCCAAAAATCTGGCCACCAGG + Intergenic
964067903 3:152599721-152599743 GTGCCAAAAATCTGGCCACCAGG + Intergenic
964176039 3:153826710-153826732 ATCCCAAAAGCCTGGCCACTGGG - Intergenic
965118652 3:164522290-164522312 GTGCAAACAGCCTGGGCACTGGG - Intergenic
965460586 3:168957108-168957130 ATGCCAAAAGTTTGGGAACTGGG - Intergenic
966398444 3:179524365-179524387 GTGCCAGAAATCTGGCCACTGGG - Intergenic
967658100 3:192074517-192074539 GTGCCAGAAATCTGGCCACTGGG - Intergenic
968413249 4:406949-406971 ATGCCAAAAGCCTGGCCACTGGG - Intergenic
969281470 4:6173503-6173525 ATGGATACAGCCTGGCCACTAGG + Intronic
969540985 4:7788765-7788787 ATGAATAAAGCCTGGCCACAGGG + Intronic
971226790 4:24761494-24761516 ATGCTCAAAGCCTGGTCCCTGGG - Intergenic
971911308 4:32800215-32800237 ATCCCAAAAGTCTTGCCACTGGG + Intergenic
974173427 4:58294753-58294775 ATGCCAGAAATCTTGCCACTGGG - Intergenic
974428391 4:61767724-61767746 ATGCCGGAAATCTGGCCACTGGG - Intronic
974720815 4:65736238-65736260 GTGCCAACAGCCTAGCCACCTGG - Intergenic
975152126 4:71033806-71033828 ATGCCAAAAGCCTGGCCCCTGGG + Intergenic
975933883 4:79557413-79557435 ATGCCAGAAATCTGGCCACTGGG - Intergenic
977010323 4:91626365-91626387 GTGCCAGAAATCTGGCCACTGGG + Intergenic
977012918 4:91658058-91658080 GTGCCAGAAATCTGGCCACTGGG - Intergenic
977422151 4:96815383-96815405 ATGCCACTGGCCTGGCCAATAGG + Intergenic
977432783 4:96953054-96953076 TTGCCTAAATCCTGCCCACTAGG - Intergenic
977698935 4:99999309-99999331 GTGACACAAGCCTGGCCAATAGG - Intergenic
979379946 4:119996196-119996218 GTGCCAAAAATCTGGCCACTGGG + Intergenic
979848214 4:125543948-125543970 ATGGTAAAAGCATGGTCACTAGG + Intergenic
980003346 4:127514882-127514904 GTGCCAGAAATCTGGCCACTGGG - Intergenic
980472436 4:133267128-133267150 ATGCCAGAAATCTGGCCACCAGG - Intergenic
980491347 4:133532593-133532615 GTGCCAGAAATCTGGCCACTGGG - Intergenic
980714424 4:136612552-136612574 ATGCCAAAAGTCTGGCCACTGGG + Intergenic
981482721 4:145254981-145255003 GTTCCAAAAATCTGGCCACTGGG - Intergenic
981745785 4:148051032-148051054 ATGCTAAAATCTTGTCCACTGGG + Intronic
982180477 4:152744768-152744790 GTGCCAGAAATCTGGCCACTGGG - Intronic
982414190 4:155111897-155111919 GTGCCAGAAATCTGGCCACTGGG - Intergenic
982613334 4:157606382-157606404 ATGACATTAGCCTGGCCAATGGG + Intergenic
983414704 4:167439240-167439262 TTGCCAGAAATCTGGCCACTGGG - Intergenic
984411734 4:179405493-179405515 GTGCCAGAAATCTGGCCACTGGG + Intergenic
985051845 4:185999071-185999093 ATCCCAAAAGCCAGGCCATCAGG - Intergenic
985064621 4:186108180-186108202 ATTTCAAAAGCCTGGAAACTTGG + Intronic
986030563 5:3889185-3889207 AAGCCACCAGCCTGGCCACTGGG + Intergenic
986290751 5:6397095-6397117 AGGCCACAGGGCTGGCCACTGGG + Intergenic
986368975 5:7061746-7061768 GTGCCAGAAATCTGGCCACTGGG - Intergenic
987486843 5:18535950-18535972 ATGCCGGAAATCTGGCCACTGGG + Intergenic
987498117 5:18672294-18672316 ATGCCGGAAATCTGGCCACTGGG - Intergenic
989615154 5:43331374-43331396 GTGCCAAAAATCTGGCCACTGGG - Intergenic
990979408 5:61588395-61588417 AGGCCAAAAGCTGGGCCTCTTGG + Intergenic
993192718 5:84700754-84700776 ATGCCGGAAATCTGGCCACTGGG + Intergenic
994126103 5:96170312-96170334 GTGCCAGAAATCTGGCCACTGGG - Intergenic
994375778 5:99014743-99014765 GTGCCAGAAATCTGGCCACTGGG - Intergenic
994778941 5:104067623-104067645 ATGCCGGAAATCTGGCCACTGGG - Intergenic
994944557 5:106369368-106369390 AAGCCAAAAGCCTTTCCTCTTGG + Intergenic
996203254 5:120701026-120701048 GTGCCAGAAATCTGGCCACTGGG - Intergenic
996574991 5:124970035-124970057 GTGCCAGAAATCTGGCCACTGGG - Intergenic
996725988 5:126673750-126673772 ATGCCAAAAGCCTGGCCACTGGG - Intergenic
996917687 5:128731821-128731843 GTGCCAGAAATCTGGCCACTGGG + Intronic
997157299 5:131574141-131574163 ATGCCAAAAGCCTGGCCACTGGG + Intronic
997769676 5:136543048-136543070 GTGCCAGAAATCTGGCCACTGGG - Intergenic
997770624 5:136549756-136549778 GTGCCAGAAATCTGGCCACTGGG - Intergenic
997772638 5:136568783-136568805 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1000885314 5:166742526-166742548 ATGCCGGAAATCTGGCCACTGGG - Intergenic
1001354304 5:171004824-171004846 ATGCCAAAAGCCTGGCCACTGGG - Intronic
1001791484 5:174461205-174461227 ATACCAAAAGCCTGGCTTCTGGG + Intergenic
1002570257 5:180136094-180136116 AGGCCAACAGCCTGGCCACCTGG + Intronic
1003099743 6:3168147-3168169 GTGCCAGAAATCTGGCCACTAGG + Intergenic
1003204053 6:3991091-3991113 ATGTCAAAAGCACGCCCACTTGG - Intergenic
1003950030 6:11108463-11108485 TTGCCACAATCTTGGCCACTGGG - Intronic
1004106272 6:12669652-12669674 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1005014653 6:21364943-21364965 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1006324859 6:33346107-33346129 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1007300980 6:40867642-40867664 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1007578753 6:42942680-42942702 ATGCAACAAGCCTGGCCCTTGGG - Intergenic
1008670821 6:53766963-53766985 ATGCCAAAAGACAGTCCACAGGG - Intergenic
1009464340 6:63952181-63952203 GTGCCAGAAATCTGGCCACTGGG + Intronic
1010829684 6:80513741-80513763 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1010841308 6:80651233-80651255 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1012689580 6:102295200-102295222 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1013161639 6:107550640-107550662 ATGCATAGAGCCTGGCCTCTGGG - Intronic
1013420582 6:109962997-109963019 AGGCCAACAGCCCGGCCTCTTGG - Intergenic
1013843674 6:114425759-114425781 ATGCCGGAAATCTGGCCACTGGG - Intergenic
1013891710 6:115034155-115034177 ATGCCGGAAATCTGGCCACTGGG + Intergenic
1014555853 6:122842103-122842125 ATGCCGGAAATCTGGCCACTGGG + Intergenic
1014793985 6:125705297-125705319 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1015165226 6:130194618-130194640 GTGCCAGAAATCTGGCCACTGGG + Intronic
1015625621 6:135178719-135178741 AAGCCAAAAGATTGGACACTTGG + Intergenic
1015801371 6:137064761-137064783 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1016518813 6:144925446-144925468 ATGCCGGAAATCTGGCCACTGGG + Intergenic
1016892893 6:149024073-149024095 TTTCCATAAGCCAGGCCACTTGG + Intronic
1017922830 6:158886468-158886490 ATGCCAAAAGCCTGGCCACTGGG - Intronic
1017935898 6:159004672-159004694 ATGCGGAAAGCCTGGTCACCTGG + Intergenic
1019068344 6:169321552-169321574 ACCCCAAAAGCCTGGGAACTAGG + Intergenic
1020532708 7:9356855-9356877 ATGCCGGAAATCTGGCCACTAGG - Intergenic
1020794220 7:12661841-12661863 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1021172676 7:17416117-17416139 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1022447408 7:30481506-30481528 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1023661089 7:42471622-42471644 AGTCCAAAGGCCTGGCAACTAGG - Intergenic
1025073295 7:55920281-55920303 AGGCCAAAAGCTTGGCCTCTTGG + Intronic
1025768695 7:64483161-64483183 GTGCCACAAGCCTGATCACTGGG + Intergenic
1027157892 7:75781427-75781449 GTGCCAGAAATCTGGCCACTGGG + Intronic
1028690184 7:93642135-93642157 GTGCCAGAAATCTGGCCACTGGG + Intronic
1029317170 7:99725542-99725564 ATGCCAAAAGCCTGGCCACTGGG + Intronic
1030193483 7:106831916-106831938 ATGCCAGAAGCCTGGCCACTGGG + Intergenic
1030445777 7:109645554-109645576 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1030820836 7:114088225-114088247 ATGGCCAAAGCCTGCCCACCAGG - Intronic
1031777350 7:125919888-125919910 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1031985335 7:128160754-128160776 ATGCCAGAAGCCAGGACTCTTGG + Intergenic
1032845451 7:135748092-135748114 ATGCCAAAGGCCTGCTCCCTGGG - Intronic
1033084723 7:138331303-138331325 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1033211524 7:139463566-139463588 GTGCCAGAAATCTGGCCACTGGG + Intronic
1033429328 7:141274699-141274721 ATTCCAAAGTCCTGGACACTTGG + Intronic
1035517957 8:252553-252575 ATTCAAAAAGACTCGCCACTCGG - Intergenic
1036070918 8:5440077-5440099 GTGCCAGAAATCTGGCCACTAGG - Intergenic
1036472324 8:9062871-9062893 GTGCCAGAAATCTGGCCACTGGG - Intronic
1036549662 8:9805214-9805236 ATGCCAAAAGCCTGGCCACTGGG + Intergenic
1036590968 8:10167732-10167754 ATGTCAAAAGCCTGGAGAGTTGG + Intronic
1036988325 8:13562572-13562594 TTCCCAAAAGCCTGGCCAGCAGG - Intergenic
1037070971 8:14648724-14648746 ATGCAAATAGCCTAGACACTCGG - Intronic
1037655757 8:20882892-20882914 AGGCCTAAAGGATGGCCACTGGG - Intergenic
1038853099 8:31299425-31299447 ATGTCAACAGTGTGGCCACTGGG + Intergenic
1040648028 8:49421773-49421795 AGGCCAAAAATCTGGCCACTGGG + Intergenic
1040978833 8:53224043-53224065 ATGTCAAAAGCATGCCCACTTGG + Intergenic
1041651837 8:60309936-60309958 GTGCCAGAAGTCTGGCCACTGGG - Intergenic
1041925425 8:63231032-63231054 AGGCTCAAAGCCTGGCCACTGGG + Intergenic
1043597449 8:81901973-81901995 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1043598850 8:81915721-81915743 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1043720911 8:83546244-83546266 GTGCCAGAAATCTGGCCACTAGG + Intergenic
1044925165 8:97203193-97203215 ATGCCGGAAATCTGGCCACTGGG + Intergenic
1048143778 8:131821459-131821481 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1049868812 8:144957695-144957717 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1050896080 9:10887041-10887063 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1050919888 9:11187661-11187683 ATCCCAGAGGACTGGCCACTAGG - Intergenic
1051675351 9:19553101-19553123 ATGCCAACAGCCTTGCTCCTGGG - Intronic
1051796858 9:20881441-20881463 ATGACAAAATTCTGGCCTCTGGG + Intronic
1052653340 9:31328689-31328711 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1052720635 9:32167947-32167969 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1053134676 9:35643123-35643145 ATGCCAAAAGCCTGGCCACTGGG + Intronic
1055233068 9:74087938-74087960 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1056522451 9:87413201-87413223 ATGCCAGAAATCTGGCCACTGGG + Intergenic
1056825369 9:89873202-89873224 CTGCCTCAGGCCTGGCCACTGGG - Intergenic
1057068119 9:92073899-92073921 ATGTCAAAAACCTGGCCACTGGG + Intronic
1059863482 9:118489109-118489131 TTGCCAGAAATCTGGCCACTGGG - Intergenic
1059978154 9:119739831-119739853 GTGCCAAAAGCCTGTCCGTTGGG + Intergenic
1060226200 9:121792599-121792621 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1060342885 9:122792548-122792570 ATGCCATAACCCTGACCTCTTGG + Intergenic
1060469244 9:123933646-123933668 ATGACTAAATTCTGGCCACTGGG - Intergenic
1060832395 9:126724630-126724652 AGGCCAAAAGCGTGGCCTCTAGG - Intergenic
1060984780 9:127813716-127813738 ATCCCAAAGCCCTGGCCCCTAGG - Exonic
1061403462 9:130381203-130381225 CTGCCTCAATCCTGGCCACTGGG + Intronic
1062312082 9:135944287-135944309 ATGTCTACAGCCTGGCCACATGG + Intronic
1062691582 9:137845014-137845036 AGGCCGAAAGCCTGGCCACTGGG + Intronic
1186395308 X:9202389-9202411 AGGCCAAAAGCTGGGCCTCTTGG + Intergenic
1187099952 X:16182592-16182614 GTGCCAGAAATCTGGCCACTAGG - Intergenic
1188200963 X:27292578-27292600 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1188552658 X:31379780-31379802 GTGCCAGAAATCTGGCCACTGGG + Intronic
1188891097 X:35611727-35611749 ATGCCAAAAGCCTGGCCACTGGG + Intergenic
1189031809 X:37459203-37459225 GTGCCAGAAATCTGGCCACTGGG - Intronic
1191761277 X:64651185-64651207 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1191825558 X:65361993-65362015 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1192185575 X:68944555-68944577 ATGCCCAAACCCAGGCCCCTAGG - Intergenic
1192706149 X:73529941-73529963 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1192764582 X:74128248-74128270 ATGCCAAAAGCCTGGCCACTGGG - Intergenic
1192914126 X:75635700-75635722 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1192916843 X:75660771-75660793 ATGCCGAAAGCATGCACACTTGG + Intergenic
1194293618 X:92103670-92103692 ATGCCGGAAATCTGGCCACTGGG - Intronic
1195841492 X:109180697-109180719 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1196073087 X:111546193-111546215 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1196227211 X:113180234-113180256 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1196469910 X:116012949-116012971 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1196992678 X:121346423-121346445 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1197352052 X:125392279-125392301 ATGCCAGAAATCTGGCCACTGGG - Intergenic
1197793642 X:130279311-130279333 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1198910036 X:141603042-141603064 ATGCCAAAAGCATGTCCACTTGG - Intronic
1198965930 X:142228826-142228848 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1200007821 X:153099443-153099465 ATGCCAAAAGCCTGGCCACTGGG - Intergenic
1200611137 Y:5328216-5328238 ATGCCAGAAATCTGGCCACTGGG - Intronic
1200659620 Y:5943457-5943479 GTGCCAGAAATCTGGCCACTGGG + Intergenic
1200812852 Y:7503004-7503026 ATGTCAAAAGCCTGGCCACTGGG + Intergenic
1201307499 Y:12563362-12563384 GTGCCAGAAATCTGGCCACTGGG - Intergenic
1201937132 Y:19421243-19421265 GTGCCAGAAATCTGGCCACTAGG + Intergenic
1202062094 Y:20898846-20898868 ATGGGAAAAACCTGGCCACTGGG + Intergenic