ID: 1036549663

View in Genome Browser
Species Human (GRCh38)
Location 8:9805217-9805239
Sequence AGGCCCAGTGGCCAGGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 19, 1: 12, 2: 4, 3: 37, 4: 580}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549663_1036549667 -4 Left 1036549663 8:9805217-9805239 CCAAAAGCCTGGCCACTGGGCCT 0: 19
1: 12
2: 4
3: 37
4: 580
Right 1036549667 8:9805236-9805258 GCCTCAGGATGCCACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549663 Original CRISPR AGGCCCAGTGGCCAGGCTTT TGG (reversed) Intergenic
900105643 1:979757-979779 AGGCCCAGTGGCTAAGCTAGAGG - Exonic
900344403 1:2204241-2204263 AGGCCCAGGTGCCCGGCTGTTGG + Intronic
900840798 1:5047127-5047149 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
900847485 1:5115402-5115424 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
901461691 1:9395770-9395792 AGGCCCAGTGGCCAGACCCAGGG + Intergenic
901875500 1:12165024-12165046 AGGCCCAGGGGTGAGGGTTTGGG - Intergenic
902134436 1:14292649-14292671 AGGCCCAGCTGGCAGGCTCTGGG + Intergenic
902374265 1:16022943-16022965 AGGCACAGTGACCAGGCCTTGGG - Intronic
902379218 1:16044820-16044842 GGGCACAGTGACCAGGCCTTGGG - Intronic
902435026 1:16392981-16393003 AGCCCCTGTGGCCAGGGGTTAGG + Intronic
902648032 1:17817596-17817618 AGGTCTAGTGGCCAGGCCTTGGG - Intronic
902733179 1:18383398-18383420 AGGCCCAGCGGCCATGTGTTTGG - Intergenic
902970410 1:20044122-20044144 TGGCCCAGTGGCCAGATTTCTGG + Intronic
903021390 1:20397692-20397714 AGGCTCAGAAGCCAGGCCTTTGG - Intergenic
903774821 1:25786258-25786280 AGCCCCTGTTGCCAGGCATTTGG + Intergenic
905381121 1:37562294-37562316 AGCCCCACAGGCCAGGCATTCGG + Intronic
905472983 1:38207187-38207209 AGGGCCAGTGGCCAGGCTGGAGG + Intergenic
905936254 1:41826625-41826647 AGGCCCAGTGGCCAGGCTTTTGG + Intronic
906049576 1:42859163-42859185 AGGCCCAGTGGCCGGGCTTTTGG - Intergenic
906746147 1:48223395-48223417 AGAGGCAGGGGCCAGGCTTTGGG + Intronic
906841867 1:49147846-49147868 AAGCCCTGTGGCCAGGTCTTAGG + Intronic
906934260 1:50198177-50198199 GGGCCCAGAGTCAAGGCTTTTGG + Intronic
907293613 1:53434526-53434548 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
907521269 1:55024880-55024902 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
907942628 1:59104263-59104285 AGGCACAGTGGCCAGGATTGGGG + Intergenic
907973616 1:59409333-59409355 AGGCCCAGGGGCCTGGCCTGTGG + Intronic
908461706 1:64353398-64353420 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
908591945 1:65645306-65645328 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
908852415 1:68388545-68388567 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
909374172 1:74921196-74921218 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
909729437 1:78874567-78874589 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
909909970 1:81247719-81247741 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
911071085 1:93832340-93832362 TGGCCCAGTGGCCAGATTTCCGG - Intronic
911147977 1:94570289-94570311 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
912507758 1:110167914-110167936 AGGCTAAGTGCCCAGGCTCTGGG - Intronic
912559799 1:110542376-110542398 AGGTCCAGTGCCCTGGCTCTGGG + Intergenic
914320404 1:146554136-146554158 GGGCCCAGTTTCCCGGCTTTAGG - Intergenic
915950608 1:160187652-160187674 AGGCACAGAGGCCAGGCTCTTGG - Intergenic
916941800 1:169685147-169685169 TGGCCCAGTGGCCAGATTTCTGG - Intronic
917435886 1:175020937-175020959 GGGCCCAGTGGAAAGGTTTTAGG - Intronic
917458160 1:175203603-175203625 AGGTCCAGGGGCCAGGCTCAGGG + Intergenic
918347128 1:183615927-183615949 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
918567660 1:185951730-185951752 TGGCCCAGTGGCCAGATTTCCGG + Intronic
918714394 1:187768927-187768949 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
919120422 1:193333805-193333827 AGGCTTACAGGCCAGGCTTTGGG - Intergenic
919726727 1:200889249-200889271 AGGCCCAGTGCCCAGATATTTGG + Intergenic
919780696 1:201218852-201218874 AGGCCCAGAAGCCAGGCAGTGGG + Intronic
919933945 1:202239199-202239221 AGGCCCAGTCGCCAGGCGCAGGG - Intronic
921108763 1:212012033-212012055 ATGCCCAGTGCTCAGGTTTTTGG - Intronic
921459770 1:215413374-215413396 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
921732962 1:218597223-218597245 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
922049523 1:221976537-221976559 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
922154057 1:223027837-223027859 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
922368509 1:224887722-224887744 AGGCCCAGTGGCCAGACTTTTGG - Intergenic
922761564 1:228135235-228135257 AGGCCCACAGGACAGGATTTGGG - Intergenic
922845407 1:228680371-228680393 AGGCCCAGTGGCCAGGCTTTTGG + Intergenic
922877093 1:228948515-228948537 TGGCCCGGTGGCCAGATTTTTGG - Intergenic
923257264 1:232232635-232232657 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
923466937 1:234256910-234256932 TGTCCCAGTGGCCACGCTTCAGG + Intronic
923962795 1:239103650-239103672 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
924037818 1:239954343-239954365 AGGCCCAGTGGCCCTGCGCTTGG - Intergenic
924896169 1:248339661-248339683 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1062832421 10:614630-614652 AGGCCCAGTGGCCATGTTTCGGG - Intronic
1063121062 10:3106115-3106137 CATCCCAGTGGCCAGGCTTCGGG + Intronic
1063509588 10:6633026-6633048 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1063784708 10:9367522-9367544 AGGCCCAGAGACCATGCTTTGGG + Intergenic
1065328030 10:24567842-24567864 AGTCCCAGAGGGCAGGCTTGGGG - Intergenic
1065443109 10:25772171-25772193 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1065610594 10:27467734-27467756 TGGCCCAGTGGCCAGGCTTTTGG - Intergenic
1066437203 10:35405911-35405933 TGGCCCAGTGGCCAGATTTCCGG + Intronic
1067190214 10:44062340-44062362 ATGCCCAGTGTCCAGGCCTGGGG + Intergenic
1067507744 10:46871122-46871144 GGGCCTAGGGGCCAGGCTGTTGG - Intergenic
1067654509 10:48180723-48180745 GGGCCTAGGGGCCAGGCTGTTGG + Intronic
1068058339 10:52037196-52037218 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1068283689 10:54909206-54909228 AAGCCCAGTCCCCAGGCTTCAGG + Intronic
1070474936 10:76820849-76820871 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1070600261 10:77861354-77861376 AGGCCCAGTAACCTGCCTTTGGG + Intronic
1070721423 10:78759912-78759934 AGGCCCAGATGCCAAGCTCTGGG - Intergenic
1071187243 10:83059428-83059450 TGGCCCAGTGGCCAGATTTCGGG - Intergenic
1071260045 10:83911460-83911482 AGGCACAGTGGAGAGGCTCTTGG + Intergenic
1071375206 10:84995398-84995420 AGGCCCAGTGGGAAGTGTTTGGG - Intergenic
1071821746 10:89286975-89286997 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1071897723 10:90084472-90084494 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1071916212 10:90297285-90297307 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1072011266 10:91304919-91304941 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1072086785 10:92087557-92087579 TGCCCCAGTGACCAAGCTTTTGG - Intronic
1072446299 10:95501535-95501557 TAGCCCAGTGGCCAAGCTGTTGG - Intronic
1072884534 10:99261870-99261892 TGGCACAGTGGCCAGATTTTTGG - Intergenic
1073394627 10:103207845-103207867 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1073595364 10:104794230-104794252 AGGCCTCGTGTCCAGGTTTTTGG + Intronic
1074362010 10:112831280-112831302 ATGCACAGTGCTCAGGCTTTTGG - Intergenic
1075013494 10:118894231-118894253 AGGTCCAGTGGCCAGGCTTTTGG - Intergenic
1075835241 10:125447329-125447351 ATGTCCAGTGGCCAGGGGTTGGG - Intergenic
1076403144 10:130196167-130196189 ATGCCCAGTGTCCAGGGGTTGGG + Intergenic
1076791846 10:132780931-132780953 AGGTCCAGGGGCCAGGCTGGGGG + Intronic
1076866090 10:133167117-133167139 AGGCCCCGTGCCCAGGCTCCAGG + Intronic
1077612196 11:3650215-3650237 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1077614017 11:3662133-3662155 AGGCCATGAGGCCAGGCTTTTGG + Intronic
1077774259 11:5254123-5254145 AGACCCAGTGGCAATGTTTTAGG - Intronic
1077801791 11:5546570-5546592 AGGACCAGTGGAGAGGTTTTAGG - Intronic
1078046115 11:7915593-7915615 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1078147723 11:8733200-8733222 AGGGCAAGTCGCCAGGCTTGAGG + Intronic
1079230524 11:18645309-18645331 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1079352433 11:19703276-19703298 AGGCCCAGTGCCCAGGGTTTAGG - Intronic
1079363840 11:19792196-19792218 AGGTCCAGGTCCCAGGCTTTAGG + Intronic
1081159713 11:39736685-39736707 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1081356816 11:42122855-42122877 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1083741060 11:64712090-64712112 AGGCCGTGTGGCGGGGCTTTGGG - Intronic
1084354201 11:68626422-68626444 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1085204582 11:74723169-74723191 AGGTACAATGGGCAGGCTTTGGG + Intronic
1085383854 11:76144662-76144684 AGGCCCAGAGGCAAGGCCTTGGG + Intergenic
1086005030 11:82027500-82027522 TGGCCCAGTGGCCAGATTTTTGG - Intergenic
1086125299 11:83343516-83343538 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1086133160 11:83421403-83421425 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1086134823 11:83435013-83435035 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1086550224 11:88045471-88045493 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1086658068 11:89383262-89383284 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1087099110 11:94347999-94348021 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1089174559 11:116539116-116539138 ATGAGAAGTGGCCAGGCTTTGGG - Intergenic
1089381801 11:118038187-118038209 AGGCCGAGGGGGCAGGCTTCGGG + Intergenic
1089867038 11:121641356-121641378 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1089953308 11:122549231-122549253 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1090425132 11:126602343-126602365 AGGACCAGAGGCCAGACTTCTGG - Intronic
1090926926 11:131257921-131257943 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1091260096 11:134226803-134226825 AGGCCTTGTGGCCTGGCTCTTGG + Intronic
1091886529 12:4020810-4020832 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1092927409 12:13284203-13284225 AGCCCCAGTGTCTAAGCTTTAGG - Intergenic
1092959118 12:13579052-13579074 AGCCCCAGTGCACAGGCTCTGGG - Intronic
1093024342 12:14232859-14232881 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1093071154 12:14708306-14708328 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1093302240 12:17471829-17471851 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1093578825 12:20765656-20765678 TGGCTCAGTGGCCAGATTTTTGG - Intergenic
1093812824 12:23509444-23509466 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1093951081 12:25165427-25165449 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1094316041 12:29138434-29138456 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1094493348 12:30975051-30975073 AGGCCAAGCGTCCAGCCTTTGGG - Intronic
1094825765 12:34267917-34267939 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1095300646 12:40580639-40580661 AGGCCCACTTGCCAAGCTATGGG + Intergenic
1095778147 12:46032138-46032160 TGGCCCACTGGCCAGGCTTTTGG - Intergenic
1095922289 12:47543391-47543413 ACTCCCAGAGGCCTGGCTTTAGG + Intergenic
1096216102 12:49798193-49798215 AGGGCCAGTGGCTAGGATTGGGG + Intronic
1096227152 12:49873446-49873468 AGGCCCAGTGCAAATGCTTTGGG + Intronic
1096526806 12:52214839-52214861 AGTCCCAGAGGGCAGACTTTGGG - Intergenic
1097417045 12:59326651-59326673 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1097592432 12:61589531-61589553 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1098173629 12:67770080-67770102 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1098402260 12:70087680-70087702 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1098630023 12:72712326-72712348 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1098653816 12:73005396-73005418 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1098919915 12:76293739-76293761 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1099188726 12:79542139-79542161 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1099762596 12:86941079-86941101 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1099872795 12:88369954-88369976 TGGCCTAGTGGCTATGCTTTTGG - Intergenic
1101913697 12:108879923-108879945 AGCCCCTGTGGACAGGCCTTGGG - Intronic
1102478887 12:113207085-113207107 AGGCGCAGTGGCCAGCACTTTGG + Intronic
1102604480 12:114058118-114058140 AGGCCCAGTGGCCGGGCTTTTGG - Intergenic
1103714363 12:122935351-122935373 AGGCACAGTGGGCAGGCCGTAGG + Exonic
1104257613 12:127154072-127154094 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1104689672 12:130816080-130816102 AGGCACAGTGGCCAGGCCTTGGG - Intronic
1104843073 12:131833869-131833891 AGGCCCCGTCCCCGGGCTTTGGG - Intronic
1105020511 12:132813627-132813649 AGACACAGTGGCCAGGCACTGGG + Intronic
1105438992 13:20400264-20400286 AGGCCCTGAGGCCAGGCTGAAGG - Intergenic
1106782234 13:33070525-33070547 AGGCCCTGGGCCCAGGTTTTGGG + Intergenic
1107075588 13:36318722-36318744 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1108051241 13:46441044-46441066 AAGCCCAGCCCCCAGGCTTTAGG + Intergenic
1108282054 13:48870555-48870577 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1108513004 13:51172147-51172169 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1108919537 13:55658406-55658428 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1108952937 13:56115850-56115872 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1109543797 13:63814665-63814687 AAGCCCAGCCCCCAGGCTTTAGG + Intergenic
1109709657 13:66144769-66144791 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1109716733 13:66229813-66229835 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1110650476 13:77936752-77936774 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1110845352 13:80185952-80185974 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1111302057 13:86360686-86360708 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1111362097 13:87189859-87189881 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1111458829 13:88516257-88516279 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1111630451 13:90841720-90841742 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1112203703 13:97303163-97303185 AGGACATGTGGGCAGGCTTTGGG + Intronic
1112236839 13:97644596-97644618 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1112300186 13:98222992-98223014 AAGCCCAGTGACCAGGGTTTTGG + Intronic
1112307650 13:98289793-98289815 AGTCCCAGATGCCAGGCTTTCGG - Intronic
1112334405 13:98502075-98502097 AGGCCAAGAGGCCAGGGTTGGGG - Intronic
1112889307 13:104211489-104211511 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1113823403 13:113231750-113231772 AGGTGCAGTGGCCAGACTTGTGG - Intronic
1114622346 14:24103666-24103688 ACTTCCTGTGGCCAGGCTTTGGG + Exonic
1115692412 14:35858575-35858597 AGTCTCAGTGGCCAGGAATTTGG + Intronic
1115904819 14:38193071-38193093 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1116613523 14:47106461-47106483 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1116952922 14:50895451-50895473 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1117141183 14:52791965-52791987 AGGGCCAGTGGCCGAGCCTTCGG - Intergenic
1117174164 14:53130676-53130698 TGGCCCAGTGGCCACATTTTCGG - Intronic
1117307118 14:54488327-54488349 AGGCCCAGTGCCAAAGCTTTGGG + Intronic
1119248332 14:73131753-73131775 AGGCCCAGTGGCCAGGCTTTTGG + Intergenic
1119317213 14:73705771-73705793 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1119560275 14:75584109-75584131 AGGCCCAGTGGCCAGGCTTCTGG + Intronic
1120618266 14:86733629-86733651 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1120912874 14:89683565-89683587 AGGCCCAGTGCCCAGCATATAGG + Intergenic
1121193291 14:92048141-92048163 TGGCCCAGTGGCCAGATTTCCGG + Exonic
1122041006 14:98987479-98987501 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1122507646 14:102241908-102241930 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1123882483 15:24689011-24689033 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1125031094 15:35076916-35076938 AAGCCCACTGGGCAGGTTTTCGG + Intergenic
1125062224 15:35438014-35438036 ATGCCAAGTGGCCAGTATTTTGG - Intronic
1125213206 15:37239627-37239649 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1125832220 15:42725138-42725160 AGGCCCAGTGGCCAGGGGTAAGG - Exonic
1125843110 15:42824170-42824192 AGGCCTAATGGGCAGGGTTTGGG - Intronic
1126087907 15:45026218-45026240 AGGCTCAGTGGCTTGGGTTTGGG + Intronic
1127606160 15:60591218-60591240 AGGCCCGGCCGCCAGGCTTGGGG - Intronic
1129205779 15:74036283-74036305 AGGCCTAGTGGAGAGGCTTGGGG - Intronic
1129810621 15:78507285-78507307 ACCCCGAGTGGGCAGGCTTTCGG - Intergenic
1130304560 15:82704532-82704554 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1130916736 15:88310961-88310983 AAGCCCAGTGATGAGGCTTTTGG + Intergenic
1131830060 15:96348464-96348486 TGGCCCAGTGGCCACGCTCCTGG + Intergenic
1131882506 15:96875256-96875278 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1132301618 15:100779631-100779653 AGGCCCAGAGGCAATGCCTTAGG + Intergenic
1133592150 16:7256252-7256274 AACCCCAGAGGCCTGGCTTTTGG - Intronic
1134342170 16:13356000-13356022 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1135459236 16:22627279-22627301 TGGCCCACTGCCCAGCCTTTAGG + Intergenic
1135829563 16:25761315-25761337 GGGACCAGTGGCCACCCTTTTGG - Intronic
1136394420 16:29985376-29985398 AGGCGCAGCGGGCTGGCTTTGGG + Exonic
1136529961 16:30861437-30861459 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1137598857 16:49742862-49742884 AGAACCAGTGGCCAGGCTAATGG + Intronic
1138396030 16:56705491-56705513 ATGCCCAGGGGCCAGGCTCAGGG + Intronic
1138804960 16:60081113-60081135 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1139225906 16:65233264-65233286 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1139486203 16:67257904-67257926 GGTCCCAGTGGCCAGGCTGGGGG - Intronic
1139943710 16:70624213-70624235 TGGCCCAGTGGCCAGATTTCCGG + Intronic
1140013130 16:71155970-71155992 GGGCCCAGTTTCCCGGCTTTAGG + Intronic
1140509824 16:75498950-75498972 GGGCCAAGTGCCCAGGCTGTTGG + Intergenic
1140515620 16:75539158-75539180 GGGCCAAGTGCCCAGGCTGTTGG + Exonic
1140868810 16:79088152-79088174 AGGCCCAGTGGCATGGCCTGGGG - Intronic
1141141003 16:81496913-81496935 TGGCCCAGCTGCCAGGCTGTGGG - Intronic
1141193187 16:81839930-81839952 AGTCCCAGTCACCTGGCTTTGGG + Intronic
1142149088 16:88504884-88504906 AGGCCCAGTGGCCTGTCCTGGGG - Intronic
1142236238 16:88923897-88923919 AGGCTCACTGGCCAGGACTTTGG + Intronic
1142247675 16:88977267-88977289 ATGCCCAGTGGCCACGCTGTAGG - Intergenic
1142285835 16:89171241-89171263 AGAGCCAGAGGCCAGGCTGTGGG - Intergenic
1143414337 17:6735034-6735056 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1144875586 17:18395419-18395441 AGCGCCAGTGGGCTGGCTTTGGG - Intergenic
1145080656 17:19891891-19891913 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1145156640 17:20549002-20549024 AGCGCCAGTGGGCTGGCTTTGGG + Intergenic
1146018133 17:29249838-29249860 TGGCCCAGAGGCCAGGATTCTGG - Intronic
1146298745 17:31671920-31671942 TGGCCCAGAGTCCAGGCTTTTGG - Intergenic
1146844143 17:36173080-36173102 AGCACCAGTGGGCTGGCTTTGGG + Intronic
1146856448 17:36261015-36261037 AGCACCAGTGGGCTGGCTTTGGG + Intronic
1146864169 17:36327360-36327382 AGCACCAGTGGGCTGGCTTTGGG - Intronic
1146872358 17:36384926-36384948 AGCACCAGTGGGCTGGCTTTGGG + Intronic
1146879716 17:36436011-36436033 AGCACCAGTGGGCTGGCTTTGGG + Intronic
1146883642 17:36457163-36457185 AGCACCAGTGGGCTGGCTTTGGG + Intergenic
1147067029 17:37927948-37927970 AGCACCAGTGGGCTGGCTTTGGG - Intronic
1147075242 17:37985550-37985572 AGCACCAGTGGGCTGGCTTTGGG + Intronic
1147078561 17:38007509-38007531 AGCACCAGTGGGCTGGCTTTGGG - Intronic
1147086767 17:38065096-38065118 AGCACCAGTGGGCTGGCTTTGGG + Intronic
1147094499 17:38131444-38131466 AGCACCAGTGGGCTGGCTTTGGG - Intergenic
1147102712 17:38189059-38189081 AGCACCAGTGGGCTGGCTTTGGG + Intergenic
1147771623 17:42872169-42872191 AGGCCCAGTCGCAAGGCATCTGG + Intergenic
1147791847 17:43018610-43018632 AGACGCTGTGGCCAGGCTGTAGG + Exonic
1147947159 17:44086666-44086688 GGGCACAGTGGCCAGGCTGAGGG + Exonic
1149847285 17:60015526-60015548 AGCACCAGTGGGCTGGCTTTGGG + Intergenic
1150069831 17:62140948-62140970 AGGCCCAGTGCCAAGGCTCAAGG + Intergenic
1150085643 17:62272143-62272165 AGCACCAGTGGGCTGGCTTTGGG + Intergenic
1151492898 17:74443287-74443309 AGGCTCCCTGGCCAGGCTCTGGG + Intronic
1151763697 17:76121686-76121708 AGGCCCAGGGGCCAGGGTCATGG + Intergenic
1152427748 17:80227688-80227710 AGGCCCAATGCCCAGGCTGCTGG - Intronic
1152428108 17:80229776-80229798 ATGCCCAGTGCCCAGGCTGCTGG - Intronic
1152453965 17:80402184-80402206 TGGCCCAGTGGCCAGGCTTTTGG - Intergenic
1153952049 18:10065811-10065833 AGGCCAAGGGGGCAGGCTGTTGG + Intergenic
1155517886 18:26641164-26641186 AGGCCCAGTGGCCAGTGGGTTGG - Intronic
1155892686 18:31287664-31287686 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1155941558 18:31806086-31806108 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1155962006 18:32002888-32002910 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1156229516 18:35140049-35140071 AAGCACAGTCGTCAGGCTTTAGG - Intronic
1156251921 18:35359737-35359759 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1156915822 18:42463850-42463872 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1156924043 18:42555919-42555941 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1156938541 18:42738933-42738955 TGGCCCAGTGGCCAGATTTCGGG - Intergenic
1156958189 18:42993155-42993177 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1157271594 18:46280422-46280444 AGGTCCAGAGGCCTGGCTTCTGG + Intergenic
1157332407 18:46713451-46713473 AGGCCCAGTGGTCAGGGCTGGGG + Intronic
1157342516 18:46791889-46791911 TGGAGCAGTTGCCAGGCTTTGGG - Intergenic
1157906381 18:51573467-51573489 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1158336386 18:56417872-56417894 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1158414998 18:57242411-57242433 AGGGTCAGTGTCCTGGCTTTAGG - Intergenic
1159835061 18:73326918-73326940 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1160412416 18:78683897-78683919 AGGCCCCGGAGCCGGGCTTTGGG - Intergenic
1160599861 18:80004300-80004322 GGTCCCAGAGTCCAGGCTTTGGG - Intronic
1161332458 19:3694811-3694833 AGGTCAAGTGGCCAGGCCTGCGG - Intronic
1161661729 19:5550752-5550774 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1161712050 19:5854391-5854413 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1162176459 19:8833136-8833158 AGGCCCAGGAGCCAGGATTGTGG + Intronic
1162286680 19:9744104-9744126 AGGCCCAGTGACCAGGCTTTTGG - Intergenic
1162394049 19:10405790-10405812 GGGCACTGTGACCAGGCTTTGGG + Intronic
1162789164 19:13054181-13054203 AGGCCCAGTGGCCAAGCTCCTGG - Intronic
1163209647 19:15831086-15831108 TGGCCCAGTGGCCAGTTTTGCGG - Intergenic
1163487299 19:17595710-17595732 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1163900214 19:20094053-20094075 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1163907193 19:20157814-20157836 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1163944443 19:20522509-20522531 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1163956718 19:20649458-20649480 AGGCCCTGTGACCACCCTTTAGG + Intronic
1164152981 19:22570522-22570544 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1165117131 19:33535260-33535282 AGGACCCGTGGGCAGCCTTTGGG - Intergenic
1165426745 19:35750127-35750149 AGGCCTAGTGGACAGGCCATGGG + Intronic
1165784354 19:38452562-38452584 AGGTCCAGGGTCCAGGCTCTGGG - Intronic
1166076690 19:40417722-40417744 AGGCCCAGCAGACAGGCTGTGGG - Intergenic
1166498930 19:43326931-43326953 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1167006412 19:46778949-46778971 GGGCCCAGTGGCCAGGCGTGAGG + Intronic
1167099466 19:47395328-47395350 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1167368392 19:49066255-49066277 AGGGCCACTTCCCAGGCTTTGGG + Intergenic
1167675954 19:50885718-50885740 AGTCCCAGAGGCCAGGCATTCGG - Intergenic
1167901109 19:52623030-52623052 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1167902159 19:52630053-52630075 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1168115969 19:54221548-54221570 AGGCACAGTGGCCAGGGCTAGGG - Intronic
1168118952 19:54241296-54241318 AGGCACAGTGGCCAGGGCTAGGG - Intronic
1168248150 19:55124822-55124844 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1168624261 19:57904428-57904450 AGCCCCAGTGACCAGGTGTTGGG + Intronic
925828811 2:7876090-7876112 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
926413598 2:12628783-12628805 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
926464083 2:13167419-13167441 TGGCCCAGTGGCCAGATTTGCGG + Intergenic
926538836 2:14149613-14149635 AGCCACACAGGCCAGGCTTTGGG - Intergenic
927097557 2:19759173-19759195 AGAGCCATTGGCCAGACTTTGGG - Intergenic
927134168 2:20084597-20084619 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
928261407 2:29770241-29770263 AGGCCTAGTGGCCATGATTCTGG - Intronic
928430607 2:31215432-31215454 AGTCCAAATGGCCAGGCTCTTGG + Intronic
929684517 2:44022472-44022494 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
931608915 2:64078598-64078620 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
931625787 2:64254810-64254832 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
932367637 2:71163112-71163134 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
932456166 2:71851383-71851405 GGGCCCAGAGCCCAGGCTGTAGG - Intergenic
932463180 2:71896527-71896549 AGGCCCAGCGACGAGGCTTGGGG + Intergenic
932854202 2:75217221-75217243 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
933329510 2:80877895-80877917 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
935264707 2:101384457-101384479 AGGCCAAGTGGGAAGGGTTTGGG + Intronic
937284635 2:120742108-120742130 AGGCCCCGTGACCAAACTTTTGG + Intronic
939083129 2:137686372-137686394 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
939084956 2:137708081-137708103 AAGCCCAGTGCCCAGGCTTCAGG + Intergenic
940182949 2:150955321-150955343 TGACCCAGTGGCCAGATTTTTGG - Intergenic
940764783 2:157778483-157778505 TGGGCCATTGGCCAGGCATTAGG - Intronic
941353394 2:164461392-164461414 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
941456178 2:165713924-165713946 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
941739207 2:169015266-169015288 AGGCCCAGCAGCCTGGCTTAAGG - Intronic
942319771 2:174726146-174726168 AGGCCAACTGGCCAGCCTGTGGG + Intergenic
942776693 2:179590364-179590386 AGTACCAGTTGCCAGGCATTGGG - Intronic
943061580 2:183046168-183046190 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
943450133 2:188035490-188035512 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
945035482 2:205700530-205700552 GGGCCCTGTTTCCAGGCTTTGGG - Intronic
945173468 2:207019529-207019551 CGGCCCAGTGGCCAGATTTCCGG - Intergenic
945394311 2:209301505-209301527 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
945554696 2:211263750-211263772 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
945858129 2:215091870-215091892 TGGCCCAGTGGCCAGATTTCCGG - Intronic
945938328 2:215924653-215924675 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
946902292 2:224384161-224384183 AGGCCCAGTGGAGGGGCTGTGGG - Intronic
947702784 2:232249165-232249187 AAGCCCAGTGGGCAGAGTTTTGG - Intronic
948085587 2:235244134-235244156 AGGCCCAGTGGGCAGGTGTGGGG - Intergenic
948237483 2:236401454-236401476 AGGCCAAGTGGCCAGGCCCCAGG - Intronic
1168943270 20:1731171-1731193 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1169145529 20:3249845-3249867 GGGCCCAGTGTCCAGGCTTCAGG + Exonic
1170165750 20:13359243-13359265 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1170602591 20:17852508-17852530 AGCACCAGTTGCCAGTCTTTTGG - Intergenic
1172475666 20:35235734-35235756 AAGACCAGTGGCCAGGCCTCAGG - Intronic
1173101922 20:40095630-40095652 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1173781733 20:45762075-45762097 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1175854603 20:62113750-62113772 AGGTCCAGTGGCCGGGGCTTAGG + Intergenic
1175874792 20:62224249-62224271 AGGTCCAGTGGCCAGGGCTCAGG + Intergenic
1176030068 20:63007466-63007488 GCGCCCTGTGGCCAGGCTTGAGG + Intergenic
1176057415 20:63155985-63156007 AGGCCCAGGGGGCTGGCTTGCGG - Intergenic
1176168978 20:63688670-63688692 AGGGCCAGTGGTCAGCCTTGGGG - Intronic
1177031163 21:15983220-15983242 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1179387566 21:40957232-40957254 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1179650356 21:42804455-42804477 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1179881353 21:44294475-44294497 AGGCCCAGGGGCCAGGCGGGCGG - Exonic
1180560952 22:16613911-16613933 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1180995532 22:19963439-19963461 AGGGCCAGCGGCCAGGCATTTGG + Intronic
1182113959 22:27744265-27744287 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1182732285 22:32505059-32505081 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1183725035 22:39583869-39583891 AGGGCCAGTGGCCAAGGTCTAGG - Intronic
1184451677 22:44586256-44586278 GAGCCCAGAGGCCAGGCTGTTGG - Intergenic
1184858021 22:47157032-47157054 AGGGGCAGTGGCCAGGCACTGGG + Intronic
1185279479 22:49963839-49963861 AGGCACTGTGCCCAGGGTTTGGG + Exonic
949526526 3:4910219-4910241 AGGCCCCGGGGCCAGGCAGTAGG + Intergenic
949933990 3:9102359-9102381 AGGCGGAGTGGCTGGGCTTTTGG - Intronic
951762786 3:26163798-26163820 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
952296881 3:32069879-32069901 AGGCCCAGTGGCCAGGCTTTTGG - Intronic
952307042 3:32155644-32155666 AAGCCCAGAGGCCAGCCCTTGGG - Intronic
952663447 3:35877753-35877775 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
952851115 3:37730311-37730333 AGGCCAATTAGCCAGGATTTAGG + Intronic
953062043 3:39435352-39435374 AGGCCCAGTGTGGAGGCTGTTGG + Intergenic
953186953 3:40646849-40646871 AGCCACAGTGCCCAGCCTTTGGG + Intergenic
953656558 3:44859112-44859134 TGGCCCAGTGGCCAGATTTATGG + Intronic
953717482 3:45328471-45328493 AGTCCCAGGGGCCAGGCATAGGG - Intergenic
953841153 3:46391166-46391188 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
954161759 3:48727757-48727779 TGGCCCAGTGGCCAGATTTCTGG + Intronic
954663163 3:52236873-52236895 AGCCCCAGAGGCCAGGCTTGGGG - Intronic
954969258 3:54637911-54637933 TGGCCCAGTGGCCAGATTTCCGG + Intronic
955253374 3:57305960-57305982 TGGCCCAGTGGCCAGATTTCTGG - Intronic
955797012 3:62647960-62647982 GTGCCCAGTAGCCAGGCCTTGGG - Intronic
957155107 3:76536080-76536102 TGGCCCAGTGGCCAGTTTTGTGG + Intronic
957295244 3:78326084-78326106 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
957317303 3:78586575-78586597 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
957394374 3:79620095-79620117 TGGCCCAGTGGCCAGATTTCTGG - Intronic
957734857 3:84191230-84191252 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
957985696 3:87571638-87571660 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
958421964 3:93940082-93940104 TGGCCCAGTGGCCAGATTTCCGG - Intronic
958755539 3:98246264-98246286 AGGCCCAGTGGCCAGGATTTTGG - Intergenic
959972258 3:112420993-112421015 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
960282868 3:115796934-115796956 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
961164754 3:124755981-124756003 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
961326493 3:126112310-126112332 GAGCCAAGTGGCCAGGCTGTGGG - Intronic
961655230 3:128438250-128438272 TGGCCCAAATGCCAGGCTTTTGG - Intergenic
961712711 3:128839611-128839633 AGGCCCAGTGGCCAGGCTTTTGG + Intergenic
962471263 3:135711326-135711348 AGAAACATTGGCCAGGCTTTGGG - Intergenic
962523959 3:136221306-136221328 AGGCCCAGTGGCCAGGCTTTTGG + Intergenic
962740950 3:138362235-138362257 AGGCTCAGTGGACAAGCTTGGGG + Intronic
963319754 3:143799564-143799586 TGGCCCAGTGGCCAGATTTCCGG - Intronic
963425226 3:145115261-145115283 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
964176037 3:153826707-153826729 AGGCCCAGTGGCCAGGCTTTTGG + Intergenic
965713417 3:171578695-171578717 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
966398443 3:179524362-179524384 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
967005353 3:185377961-185377983 TGGCCCAGTGGCCAGATTTCCGG + Intronic
967285944 3:187870548-187870570 AGGACCAGAGGCCAGTATTTGGG - Intergenic
967566178 3:190976130-190976152 AATACCAGTTGCCAGGCTTTTGG + Intergenic
967658099 3:192074514-192074536 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
967740494 3:192997964-192997986 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
968413248 4:406946-406968 AGGCCCAGTGGCCAGGCTTTTGG + Intergenic
968533136 4:1105969-1105991 AGGCCCTGTGGCCTGGCCTCTGG - Intronic
968872477 4:3248784-3248806 AGGGCCAGTGGCCAGCGTTGGGG + Exonic
970565193 4:17325106-17325128 TTGCTCAGTGGCTAGGCTTTGGG - Intergenic
973816893 4:54627318-54627340 AGGCCCAAAGGACAGGCTTTGGG - Intergenic
974428390 4:61767721-61767743 TGGCCCAGTGGCCAGATTTCCGG + Intronic
975152127 4:71033809-71033831 AGGCCCAGGGGCCAGGCTTTTGG - Intergenic
975814425 4:78202852-78202874 TGGCCCTGTGGCCAGGATCTAGG + Intronic
975933882 4:79557410-79557432 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
976696544 4:87924146-87924168 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
976739949 4:88347180-88347202 GGGCCCAGTGGCCAGATTTCCGG + Intergenic
977010324 4:91626368-91626390 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
977012917 4:91658055-91658077 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
977446431 4:97138034-97138056 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
979283533 4:118895231-118895253 AGTCACTGTGGCCAGGCTTGTGG + Intronic
979379947 4:119996199-119996221 TGGCCCAGTGGCCAGATTTTTGG - Intergenic
980003345 4:127514879-127514901 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
980491346 4:133532590-133532612 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
980714425 4:136612555-136612577 AGGCCCAGTGGCCAGACTTTTGG - Intergenic
981482720 4:145254978-145255000 TGGCCCAGTGGCCAGATTTTTGG + Intergenic
981539731 4:145835023-145835045 TGGCCCAGTGGCCAGATTTCCGG - Intronic
982180476 4:152744765-152744787 TGGCCCAGTGGCCAGATTTCTGG + Intronic
982208183 4:153012983-153013005 AGGGCCTGTGGCTGGGCTTTAGG - Intergenic
982293379 4:153802476-153802498 AAGGCCTGAGGCCAGGCTTTCGG - Intergenic
982414189 4:155111894-155111916 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
982535453 4:156602560-156602582 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
983414703 4:167439237-167439259 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
983805782 4:171989463-171989485 TGGCCCAGTGGCCAGATTTCCGG + Intronic
984411735 4:179405496-179405518 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
985295740 4:188435533-188435555 TAGCTCAGTGGCCAGGCTCTTGG - Intergenic
985389862 4:189482896-189482918 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
985781978 5:1876375-1876397 AGGCCCTGTCGCCAGGGTTCAGG + Intergenic
985980538 5:3458683-3458705 AGGCCCAGTGCCCCAGCTCTTGG - Intergenic
986368974 5:7061743-7061765 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
986399829 5:7370103-7370125 AGGGCCTGTGCACAGGCTTTGGG + Intergenic
986919579 5:12665972-12665994 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
987486844 5:18535953-18535975 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
987498116 5:18672291-18672313 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
988473119 5:31559005-31559027 AGGCCCAAAGGCCAGCTTTTTGG + Intergenic
989107302 5:37875674-37875696 AGGTCCATTGACCAGTCTTTAGG + Intergenic
989615153 5:43331371-43331393 TGGCCCAGTGGCCAGATTTTTGG + Intergenic
991610608 5:68446057-68446079 AGACAGAGTGGCCAGGTTTTGGG - Intergenic
992459496 5:76946990-76947012 AGGCCCAGAGGCCAGGGGGTAGG - Intergenic
993192719 5:84700757-84700779 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
994126102 5:96170309-96170331 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
994375777 5:99014740-99014762 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
994778940 5:104067620-104067642 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
996203253 5:120701023-120701045 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
996574990 5:124970032-124970054 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
996725987 5:126673747-126673769 AGGCCCAGTGGCCAGGCTTTTGG + Intergenic
996785194 5:127229848-127229870 ACGCCCAGGGCGCAGGCTTTCGG + Intergenic
996917688 5:128731824-128731846 TGGCCCAGTGGCCAGATTTCTGG - Intronic
997157300 5:131574144-131574166 AGGCCCAGTGGCCAGGCTTTTGG - Intronic
997769675 5:136543045-136543067 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
997770623 5:136549753-136549775 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
997772637 5:136568780-136568802 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
998173025 5:139883404-139883426 AGGCCCCGTGCCCAGGATTTGGG + Intronic
998523708 5:142823476-142823498 AGTCCCAAGAGCCAGGCTTTAGG - Intronic
998995397 5:147865553-147865575 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1000885313 5:166742523-166742545 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1001354303 5:171004821-171004843 AGGCCCAGTGGCCAGGCTTTTGG + Intronic
1001526999 5:172436254-172436276 AGGCCCCGTGGGTGGGCTTTTGG + Intronic
1001780473 5:174364612-174364634 TGGCCCAGGGACCATGCTTTGGG - Intergenic
1002570258 5:180136097-180136119 GGGCCAGGTGGCCAGGCTGTTGG - Intronic
1004106273 6:12669655-12669677 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1004888081 6:20071039-20071061 AGGCCCAGAGGGCCTGCTTTGGG - Intergenic
1005014652 6:21364940-21364962 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1005786566 6:29250639-29250661 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1006324860 6:33346110-33346132 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1006713359 6:36095429-36095451 TGCTCCAGTGGTCAGGCTTTGGG + Intronic
1007029603 6:38616102-38616124 AGGCCCATTGGCTAGGACTTGGG + Intronic
1007290302 6:40780708-40780730 AGGCCCACTGGCCAGGACCTGGG + Intergenic
1007300979 6:40867639-40867661 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1009464341 6:63952184-63952206 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1009887257 6:69638872-69638894 AGCTCCAGTGCCCAGGCTTTTGG + Intergenic
1010586690 6:77663988-77664010 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1010829683 6:80513738-80513760 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1010841307 6:80651230-80651252 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1011006050 6:82646787-82646809 AGGGCCAGAGGCCTGGCTTCAGG - Intergenic
1011770936 6:90673645-90673667 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1012689581 6:102295203-102295225 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1013843673 6:114425756-114425778 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1013891711 6:115034158-115034180 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1014115334 6:117663118-117663140 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1014555854 6:122842106-122842128 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1014718902 6:124894314-124894336 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1014793984 6:125705294-125705316 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1015165227 6:130194621-130194643 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1015266743 6:131297733-131297755 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1015278161 6:131405090-131405112 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1015801370 6:137064758-137064780 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1016248868 6:142018085-142018107 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1016518814 6:144925449-144925471 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1016892894 6:149024076-149024098 TGGCCAAGTGGCCTGGCTTATGG - Intronic
1017922829 6:158886465-158886487 AGGCCCAGTGGCCAGGCTTTTGG + Intronic
1019068347 6:169321555-169321577 AAGCCTAGTTCCCAGGCTTTTGG - Intergenic
1019555170 7:1625680-1625702 AGCCCCAGTGTCCAGCCCTTGGG + Intergenic
1019734121 7:2642023-2642045 GGGGCCAGAGGCCAGGCTTCGGG - Intronic
1020225368 7:6275498-6275520 CGGCCCAGTCCCCAGGCTTATGG + Intergenic
1020794221 7:12661844-12661866 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1021172677 7:17416120-17416142 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1022447409 7:30481509-30481531 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1022707461 7:32817616-32817638 AGGACCAGTGGACTGCCTTTTGG + Intergenic
1022910970 7:34899213-34899235 ATGCCAGGTGGCCAGGGTTTGGG - Intergenic
1023061151 7:36328428-36328450 AGGCTCAGTAGGAAGGCTTTAGG + Intronic
1023284605 7:38606129-38606151 AAGCCCAGTCCCCATGCTTTAGG + Intronic
1023908884 7:44540294-44540316 AGGCGCAGTAGCCAGGCTGGTGG + Exonic
1024276763 7:47683833-47683855 GAGCCCAGTGGCCAGGAATTTGG + Intergenic
1024548362 7:50540652-50540674 AGGGGCAGTGGCCAGGCTGAGGG - Intronic
1027157893 7:75781430-75781452 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1027851953 7:83461942-83461964 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1027858663 7:83546438-83546460 AGGCACAGAGTCCAGTCTTTTGG + Intronic
1028649787 7:93138732-93138754 AGGCCCAGTGCCCTGGCTCTGGG - Intronic
1028735849 7:94211224-94211246 AGGCCCAGTGGCTGGGGTTGGGG - Intergenic
1029317171 7:99725545-99725567 AGGCCCAGTGGCCAGGCTTTTGG - Intronic
1029595719 7:101536619-101536641 AGCCCCAGTGTCCAGGCTCTGGG - Intronic
1030193484 7:106831919-106831941 AGGCCCAGTGGCCAGGCTTCTGG - Intergenic
1030445776 7:109645551-109645573 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1031004676 7:116457761-116457783 TGGCCCAGTGGCCAGATTTCCGG - Intronic
1031777351 7:125919891-125919913 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1033084724 7:138331306-138331328 CGGCCCAGTGGCCAGATTTCTGG - Intergenic
1033211525 7:139463569-139463591 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1033625595 7:143107099-143107121 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1033675943 7:143540655-143540677 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1033686729 7:143647144-143647166 AGGGGCAGTGGCCAGGGTTCTGG + Intronic
1033689005 7:143720163-143720185 AGGGGCAGTGGCCAGGGTTCTGG - Exonic
1033697880 7:143810470-143810492 AGGGGCAGTGGCCAGGGTTCTGG - Intergenic
1033879890 7:145868654-145868676 ATGCCCAGTGGGCTGGCTTTGGG + Intergenic
1034675693 7:152891283-152891305 ACGCCCAGTGGGCACGCTGTGGG - Intergenic
1035783186 8:2244532-2244554 AGGCCCAGTGCTGAGGCTTAGGG + Intergenic
1036472323 8:9062868-9062890 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1036549663 8:9805217-9805239 AGGCCCAGTGGCCAGGCTTTTGG - Intergenic
1037655756 8:20882889-20882911 AGGCCCAGTGGCCATCCTTTAGG + Intergenic
1040648029 8:49421776-49421798 TGGCCCAGTGGCCAGATTTTTGG - Intergenic
1041651836 8:60309933-60309955 TGGCCCAGTGGCCAGACTTCTGG + Intergenic
1041745912 8:61209224-61209246 AGGCTCAGGGGCCAATCTTTGGG + Intronic
1042453565 8:68975449-68975471 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1042707377 8:71677189-71677211 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1043597448 8:81901970-81901992 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1043598851 8:81915724-81915746 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1044921999 8:97177352-97177374 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1044925166 8:97203196-97203218 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1045197529 8:99946147-99946169 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1046440020 8:114243614-114243636 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1046620698 8:116526593-116526615 AGGCCCAGTGGAGGGGCTCTTGG - Intergenic
1047699354 8:127434005-127434027 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1048143779 8:131821462-131821484 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1048283610 8:133123694-133123716 AGACCCTGTGGCCAGGTTTGGGG + Intronic
1048627188 8:136198101-136198123 AGGCCTAGAGCCCAGTCTTTTGG + Intergenic
1048905393 8:139082878-139082900 ATGCCCAGTGTCCAATCTTTGGG + Intergenic
1049288748 8:141790711-141790733 AGGCCGAGTGGACAGGCTGAGGG + Intergenic
1049868811 8:144957692-144957714 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1049940888 9:545109-545131 AAGCCCAGTGCCCAGACTTCTGG + Intronic
1049940904 9:545211-545233 AAGCCCAGTGCCCAGACTTCTGG + Intronic
1050896081 9:10887044-10887066 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1051052632 9:12950599-12950621 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1052653341 9:31328692-31328714 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1052720634 9:32167944-32167966 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1053015726 9:34660887-34660909 AGGCCAAGAACCCAGGCTTTGGG - Exonic
1053134677 9:35643126-35643148 AGGCCCAGTGGCCAGGCTTTTGG - Intronic
1053313343 9:37033243-37033265 AGGCCCAGTGTCCATTCTATTGG - Intronic
1055233069 9:74087941-74087963 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1055440135 9:76329163-76329185 AGGCGCAGTACCCAGGCTGTTGG + Intronic
1055744966 9:79433557-79433579 AGTCCCAGTGGGCAGGCCTCCGG - Intergenic
1056323893 9:85460924-85460946 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1056522452 9:87413204-87413226 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1056882986 9:90414853-90414875 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1057128614 9:92638164-92638186 GGGCCCACTGGCCAGGCCGTTGG + Exonic
1057234854 9:93349883-93349905 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1057684008 9:97217121-97217143 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1059606701 9:115842637-115842659 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1059863481 9:118489106-118489128 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1060215688 9:121737072-121737094 AGGCCCAGAGGCGGGGCTTGGGG + Intronic
1060226201 9:121792602-121792624 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1060941562 9:127545755-127545777 AGCCCCAGTGGGCGGGTTTTGGG - Intronic
1060978080 9:127777031-127777053 AGGCCCAGAGTCCAGGGTCTGGG + Intronic
1061403463 9:130381206-130381228 GAGCCCAGTGGCCAGGATTGAGG - Intronic
1061742202 9:132715527-132715549 AGGGCCAGGGCCCAGGCTCTAGG - Intergenic
1061924887 9:133801136-133801158 AGGACCTGTGTCCAGGCTTGTGG - Intronic
1061968582 9:134030809-134030831 AGGCCGAGGGGGCAGGCTTCGGG - Exonic
1062181738 9:135194596-135194618 AGGCTCAGTGGCCAGGCTGAGGG + Intergenic
1062233824 9:135498616-135498638 AGGACCAGTAACCAGGCTTACGG - Exonic
1062289367 9:135787632-135787654 AGACTCAGAGGCCAGGGTTTGGG + Intronic
1062640012 9:137514281-137514303 GGGCCCTGTGGCCGGGCTGTGGG + Intronic
1062640103 9:137514564-137514586 GGGCCCTGTGGCCGGGCTGTGGG + Intronic
1062691583 9:137845017-137845039 AGGCCCAGTGGCCAGGCTTTCGG - Intronic
1186209198 X:7232176-7232198 AGGCCCAGGGGCCAGGAGTTTGG + Intronic
1186601406 X:11041653-11041675 AGGCAAGGGGGCCAGGCTTTTGG - Intergenic
1187669827 X:21657193-21657215 AGGCCCAGTAGCCGGGCCTCGGG + Exonic
1188149836 X:26658630-26658652 AGCCACTGTGCCCAGGCTTTTGG + Intergenic
1188200962 X:27292575-27292597 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1188301051 X:28505857-28505879 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1188552659 X:31379783-31379805 TGGCCCAGTGGCCAGATTTCTGG - Intronic
1188891098 X:35611730-35611752 AGGCCCAGTGGCCAGGCTTTTGG - Intergenic
1189031808 X:37459200-37459222 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1189240128 X:39518512-39518534 AGGCACAGTGGGCTGGCTTAGGG - Intergenic
1189297855 X:39931269-39931291 CAGCCTAGTGGCCTGGCTTTGGG - Intergenic
1190042704 X:47084121-47084143 AAGCCCAGTGGCCATGATATGGG - Intronic
1190369498 X:49727305-49727327 CGGCCCAGTCCCCAGGCTTCAGG - Intergenic
1191014187 X:55791738-55791760 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1191761278 X:64651188-64651210 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1191825559 X:65361996-65362018 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1192764581 X:74128245-74128267 AGGCCCAGTGGCCAGGCTTTTGG + Intergenic
1192914125 X:75635697-75635719 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1193941505 X:87684168-87684190 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1194293617 X:92103667-92103689 TGGCCCAGTGGCCAGATTTCCGG + Intronic
1194493259 X:94577718-94577740 AGGCCCACTGTCCAGGCTGTAGG + Intergenic
1194584516 X:95716428-95716450 AGGCATATTGGCCAGGGTTTTGG - Intergenic
1195016945 X:100789851-100789873 TGGCCCAGTGGCCAGATTTCCGG + Intergenic
1195377862 X:104245147-104245169 TGGCCCAGTGCCGAGGCTTGGGG + Intergenic
1195841493 X:109180700-109180722 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1196073088 X:111546196-111546218 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1196227210 X:113180231-113180253 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1196330831 X:114469042-114469064 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1196469911 X:116012952-116012974 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1196496873 X:116333102-116333124 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1196585131 X:117419942-117419964 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1196864817 X:120061304-120061326 AGTCCCAGAGGCCAGGGTTGGGG + Intergenic
1196878284 X:120175027-120175049 AGTCCCAGAGGCCAGGGTTGGGG - Intergenic
1196992677 X:121346420-121346442 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1197352051 X:125392276-125392298 TGGCCCAGTGGCCAGATTTCTGG + Intergenic
1197663012 X:129194077-129194099 AGGCCCAGAGGACTGGCTCTTGG - Intergenic
1197793643 X:130279314-130279336 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1197933091 X:131714351-131714373 TGGCCCAGTGGCCAGATTTCCGG - Intergenic
1200007820 X:153099440-153099462 AGGCCCAGTGGCCAGGCTTTTGG + Intergenic
1200225055 X:154412584-154412606 AAGCCCAGTGTCCTGGCTTCAGG + Intronic
1200611136 Y:5328213-5328235 TGGCCCAGTGGCCAGATTTCTGG + Intronic
1200659621 Y:5943460-5943482 TGGCCCAGTGGCCAGATTTCTGG - Intergenic
1201307498 Y:12563359-12563381 TGGCCCAGTGGCCAGATTTCTGG + Intergenic