ID: 1036549664

View in Genome Browser
Species Human (GRCh38)
Location 8:9805221-9805243
Sequence AAGCCTGGCCACTGGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549655_1036549664 24 Left 1036549655 8:9805174-9805196 CCGGGGCTCCTTCAAAACTTCCT No data
Right 1036549664 8:9805221-9805243 AAGCCTGGCCACTGGGCCTCAGG No data
1036549658_1036549664 4 Left 1036549658 8:9805194-9805216 CCTCGTGGACCTTGCTTCAGATG No data
Right 1036549664 8:9805221-9805243 AAGCCTGGCCACTGGGCCTCAGG No data
1036549654_1036549664 25 Left 1036549654 8:9805173-9805195 CCCGGGGCTCCTTCAAAACTTCC No data
Right 1036549664 8:9805221-9805243 AAGCCTGGCCACTGGGCCTCAGG No data
1036549657_1036549664 16 Left 1036549657 8:9805182-9805204 CCTTCAAAACTTCCTCGTGGACC No data
Right 1036549664 8:9805221-9805243 AAGCCTGGCCACTGGGCCTCAGG No data
1036549659_1036549664 -5 Left 1036549659 8:9805203-9805225 CCTTGCTTCAGATGCCAAAAGCC No data
Right 1036549664 8:9805221-9805243 AAGCCTGGCCACTGGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549664 Original CRISPR AAGCCTGGCCACTGGGCCTC AGG Intergenic
No off target data available for this crispr