ID: 1036549667

View in Genome Browser
Species Human (GRCh38)
Location 8:9805236-9805258
Sequence GCCTCAGGATGCCACAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036549663_1036549667 -4 Left 1036549663 8:9805217-9805239 CCAAAAGCCTGGCCACTGGGCCT 0: 19
1: 12
2: 4
3: 37
4: 580
Right 1036549667 8:9805236-9805258 GCCTCAGGATGCCACAGCCCAGG No data
1036549658_1036549667 19 Left 1036549658 8:9805194-9805216 CCTCGTGGACCTTGCTTCAGATG No data
Right 1036549667 8:9805236-9805258 GCCTCAGGATGCCACAGCCCAGG No data
1036549659_1036549667 10 Left 1036549659 8:9805203-9805225 CCTTGCTTCAGATGCCAAAAGCC No data
Right 1036549667 8:9805236-9805258 GCCTCAGGATGCCACAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036549667 Original CRISPR GCCTCAGGATGCCACAGCCC AGG Intergenic
No off target data available for this crispr