ID: 1036552653

View in Genome Browser
Species Human (GRCh38)
Location 8:9828748-9828770
Sequence CAGGCTTCAGCAGAGCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036552653_1036552661 -6 Left 1036552653 8:9828748-9828770 CCCACCCGCTCTGCTGAAGCCTG No data
Right 1036552661 8:9828765-9828787 AGCCTGCAGGGGAGGCTGCACGG No data
1036552653_1036552664 0 Left 1036552653 8:9828748-9828770 CCCACCCGCTCTGCTGAAGCCTG No data
Right 1036552664 8:9828771-9828793 CAGGGGAGGCTGCACGGGCAAGG No data
1036552653_1036552665 28 Left 1036552653 8:9828748-9828770 CCCACCCGCTCTGCTGAAGCCTG No data
Right 1036552665 8:9828799-9828821 GACGCATCCTCTCAGAGAAGAGG No data
1036552653_1036552662 -5 Left 1036552653 8:9828748-9828770 CCCACCCGCTCTGCTGAAGCCTG No data
Right 1036552662 8:9828766-9828788 GCCTGCAGGGGAGGCTGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036552653 Original CRISPR CAGGCTTCAGCAGAGCGGGT GGG (reversed) Intergenic
No off target data available for this crispr