ID: 1036555550

View in Genome Browser
Species Human (GRCh38)
Location 8:9856583-9856605
Sequence CAGGATCATGTTCTTTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036555544_1036555550 8 Left 1036555544 8:9856552-9856574 CCTCCAGTTCCATCCATGTTGTG 0: 15
1: 547
2: 1732
3: 4130
4: 7960
Right 1036555550 8:9856583-9856605 CAGGATCATGTTCTTTTTTATGG No data
1036555546_1036555550 5 Left 1036555546 8:9856555-9856577 CCAGTTCCATCCATGTTGTGGCA 0: 20
1: 772
2: 2035
3: 4017
4: 7649
Right 1036555550 8:9856583-9856605 CAGGATCATGTTCTTTTTTATGG No data
1036555547_1036555550 -1 Left 1036555547 8:9856561-9856583 CCATCCATGTTGTGGCAAACGAC No data
Right 1036555550 8:9856583-9856605 CAGGATCATGTTCTTTTTTATGG No data
1036555549_1036555550 -5 Left 1036555549 8:9856565-9856587 CCATGTTGTGGCAAACGACAGGA No data
Right 1036555550 8:9856583-9856605 CAGGATCATGTTCTTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036555550 Original CRISPR CAGGATCATGTTCTTTTTTA TGG Intergenic
No off target data available for this crispr