ID: 1036556416

View in Genome Browser
Species Human (GRCh38)
Location 8:9863843-9863865
Sequence CCCAGGACGCAGATTTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036556416_1036556420 -6 Left 1036556416 8:9863843-9863865 CCTGTAGAAATCTGCGTCCTGGG No data
Right 1036556420 8:9863860-9863882 CCTGGGTATAGATTTGGCTTTGG No data
1036556416_1036556421 -5 Left 1036556416 8:9863843-9863865 CCTGTAGAAATCTGCGTCCTGGG No data
Right 1036556421 8:9863861-9863883 CTGGGTATAGATTTGGCTTTGGG No data
1036556416_1036556422 -4 Left 1036556416 8:9863843-9863865 CCTGTAGAAATCTGCGTCCTGGG No data
Right 1036556422 8:9863862-9863884 TGGGTATAGATTTGGCTTTGGGG No data
1036556416_1036556423 -3 Left 1036556416 8:9863843-9863865 CCTGTAGAAATCTGCGTCCTGGG No data
Right 1036556423 8:9863863-9863885 GGGTATAGATTTGGCTTTGGGGG No data
1036556416_1036556424 11 Left 1036556416 8:9863843-9863865 CCTGTAGAAATCTGCGTCCTGGG No data
Right 1036556424 8:9863877-9863899 CTTTGGGGGAGCCGTCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036556416 Original CRISPR CCCAGGACGCAGATTTCTAC AGG (reversed) Intergenic
No off target data available for this crispr