ID: 1036561907

View in Genome Browser
Species Human (GRCh38)
Location 8:9905496-9905518
Sequence CGCAGGAGGCGAGCCGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036561898_1036561907 8 Left 1036561898 8:9905465-9905487 CCGAACTGCTTGCTGCCTTCGCT No data
Right 1036561907 8:9905496-9905518 CGCAGGAGGCGAGCCGGCGCTGG No data
1036561895_1036561907 20 Left 1036561895 8:9905453-9905475 CCACGGCCAAGCCCGAACTGCTT No data
Right 1036561907 8:9905496-9905518 CGCAGGAGGCGAGCCGGCGCTGG No data
1036561897_1036561907 9 Left 1036561897 8:9905464-9905486 CCCGAACTGCTTGCTGCCTTCGC No data
Right 1036561907 8:9905496-9905518 CGCAGGAGGCGAGCCGGCGCTGG No data
1036561894_1036561907 23 Left 1036561894 8:9905450-9905472 CCGCCACGGCCAAGCCCGAACTG No data
Right 1036561907 8:9905496-9905518 CGCAGGAGGCGAGCCGGCGCTGG No data
1036561896_1036561907 14 Left 1036561896 8:9905459-9905481 CCAAGCCCGAACTGCTTGCTGCC No data
Right 1036561907 8:9905496-9905518 CGCAGGAGGCGAGCCGGCGCTGG No data
1036561904_1036561907 -7 Left 1036561904 8:9905480-9905502 CCTTCGCTGGGGAAGGCGCAGGA No data
Right 1036561907 8:9905496-9905518 CGCAGGAGGCGAGCCGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036561907 Original CRISPR CGCAGGAGGCGAGCCGGCGC TGG Intergenic