ID: 1036562248

View in Genome Browser
Species Human (GRCh38)
Location 8:9906901-9906923
Sequence TCCATCTGGCCCGGGCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036562248_1036562252 -7 Left 1036562248 8:9906901-9906923 CCAGCGCGCCCGGGCCAGATGGA No data
Right 1036562252 8:9906917-9906939 AGATGGACGCCCGAGATTAGAGG No data
1036562248_1036562255 16 Left 1036562248 8:9906901-9906923 CCAGCGCGCCCGGGCCAGATGGA No data
Right 1036562255 8:9906940-9906962 CGCAGAAGTGCGCTCCACGACGG No data
1036562248_1036562256 17 Left 1036562248 8:9906901-9906923 CCAGCGCGCCCGGGCCAGATGGA No data
Right 1036562256 8:9906941-9906963 GCAGAAGTGCGCTCCACGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036562248 Original CRISPR TCCATCTGGCCCGGGCGCGC TGG (reversed) Intergenic
No off target data available for this crispr