ID: 1036564486

View in Genome Browser
Species Human (GRCh38)
Location 8:9926713-9926735
Sequence CACAGGCACATGGTTACATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036564486_1036564499 26 Left 1036564486 8:9926713-9926735 CCCTATGTAACCATGTGCCTGTG No data
Right 1036564499 8:9926762-9926784 GAGTGGTTTTGACTGGGGAAAGG No data
1036564486_1036564496 20 Left 1036564486 8:9926713-9926735 CCCTATGTAACCATGTGCCTGTG No data
Right 1036564496 8:9926756-9926778 GCTCCAGAGTGGTTTTGACTGGG No data
1036564486_1036564497 21 Left 1036564486 8:9926713-9926735 CCCTATGTAACCATGTGCCTGTG No data
Right 1036564497 8:9926757-9926779 CTCCAGAGTGGTTTTGACTGGGG No data
1036564486_1036564500 27 Left 1036564486 8:9926713-9926735 CCCTATGTAACCATGTGCCTGTG No data
Right 1036564500 8:9926763-9926785 AGTGGTTTTGACTGGGGAAAGGG No data
1036564486_1036564492 9 Left 1036564486 8:9926713-9926735 CCCTATGTAACCATGTGCCTGTG No data
Right 1036564492 8:9926745-9926767 CCTCACCCTCAGCTCCAGAGTGG No data
1036564486_1036564495 19 Left 1036564486 8:9926713-9926735 CCCTATGTAACCATGTGCCTGTG No data
Right 1036564495 8:9926755-9926777 AGCTCCAGAGTGGTTTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036564486 Original CRISPR CACAGGCACATGGTTACATA GGG (reversed) Intergenic
No off target data available for this crispr