ID: 1036567261

View in Genome Browser
Species Human (GRCh38)
Location 8:9948212-9948234
Sequence AATTGTCCAAGGAGAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036567261_1036567268 13 Left 1036567261 8:9948212-9948234 CCTGCTCTTCTCCTTGGACAATT No data
Right 1036567268 8:9948248-9948270 GGCACCAACCCACACCACCCTGG No data
1036567261_1036567273 17 Left 1036567261 8:9948212-9948234 CCTGCTCTTCTCCTTGGACAATT No data
Right 1036567273 8:9948252-9948274 CCAACCCACACCACCCTGGGGGG No data
1036567261_1036567265 -8 Left 1036567261 8:9948212-9948234 CCTGCTCTTCTCCTTGGACAATT No data
Right 1036567265 8:9948227-9948249 GGACAATTCCGTTTGGGCCAAGG No data
1036567261_1036567269 14 Left 1036567261 8:9948212-9948234 CCTGCTCTTCTCCTTGGACAATT No data
Right 1036567269 8:9948249-9948271 GCACCAACCCACACCACCCTGGG No data
1036567261_1036567271 16 Left 1036567261 8:9948212-9948234 CCTGCTCTTCTCCTTGGACAATT No data
Right 1036567271 8:9948251-9948273 ACCAACCCACACCACCCTGGGGG No data
1036567261_1036567270 15 Left 1036567261 8:9948212-9948234 CCTGCTCTTCTCCTTGGACAATT No data
Right 1036567270 8:9948250-9948272 CACCAACCCACACCACCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036567261 Original CRISPR AATTGTCCAAGGAGAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr