ID: 1036567264

View in Genome Browser
Species Human (GRCh38)
Location 8:9948223-9948245
Sequence GGCCCAAACGGAATTGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036567264_1036567268 2 Left 1036567264 8:9948223-9948245 CCTTGGACAATTCCGTTTGGGCC No data
Right 1036567268 8:9948248-9948270 GGCACCAACCCACACCACCCTGG No data
1036567264_1036567279 21 Left 1036567264 8:9948223-9948245 CCTTGGACAATTCCGTTTGGGCC No data
Right 1036567279 8:9948267-9948289 CTGGGGGGTACTCAGCTTTTTGG No data
1036567264_1036567270 4 Left 1036567264 8:9948223-9948245 CCTTGGACAATTCCGTTTGGGCC No data
Right 1036567270 8:9948250-9948272 CACCAACCCACACCACCCTGGGG No data
1036567264_1036567269 3 Left 1036567264 8:9948223-9948245 CCTTGGACAATTCCGTTTGGGCC No data
Right 1036567269 8:9948249-9948271 GCACCAACCCACACCACCCTGGG No data
1036567264_1036567280 22 Left 1036567264 8:9948223-9948245 CCTTGGACAATTCCGTTTGGGCC No data
Right 1036567280 8:9948268-9948290 TGGGGGGTACTCAGCTTTTTGGG No data
1036567264_1036567273 6 Left 1036567264 8:9948223-9948245 CCTTGGACAATTCCGTTTGGGCC No data
Right 1036567273 8:9948252-9948274 CCAACCCACACCACCCTGGGGGG No data
1036567264_1036567271 5 Left 1036567264 8:9948223-9948245 CCTTGGACAATTCCGTTTGGGCC No data
Right 1036567271 8:9948251-9948273 ACCAACCCACACCACCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036567264 Original CRISPR GGCCCAAACGGAATTGTCCA AGG (reversed) Intergenic
No off target data available for this crispr