ID: 1036567265

View in Genome Browser
Species Human (GRCh38)
Location 8:9948227-9948249
Sequence GGACAATTCCGTTTGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036567261_1036567265 -8 Left 1036567261 8:9948212-9948234 CCTGCTCTTCTCCTTGGACAATT No data
Right 1036567265 8:9948227-9948249 GGACAATTCCGTTTGGGCCAAGG No data
1036567260_1036567265 -7 Left 1036567260 8:9948211-9948233 CCCTGCTCTTCTCCTTGGACAAT No data
Right 1036567265 8:9948227-9948249 GGACAATTCCGTTTGGGCCAAGG No data
1036567257_1036567265 24 Left 1036567257 8:9948180-9948202 CCATTTTCTGTTCTCCAGGGGAA No data
Right 1036567265 8:9948227-9948249 GGACAATTCCGTTTGGGCCAAGG No data
1036567258_1036567265 10 Left 1036567258 8:9948194-9948216 CCAGGGGAACTGCTCTTCCCTGC No data
Right 1036567265 8:9948227-9948249 GGACAATTCCGTTTGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036567265 Original CRISPR GGACAATTCCGTTTGGGCCA AGG Intergenic
No off target data available for this crispr