ID: 1036567273

View in Genome Browser
Species Human (GRCh38)
Location 8:9948252-9948274
Sequence CCAACCCACACCACCCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036567266_1036567273 -6 Left 1036567266 8:9948235-9948257 CCGTTTGGGCCAAGGCACCAACC No data
Right 1036567273 8:9948252-9948274 CCAACCCACACCACCCTGGGGGG No data
1036567261_1036567273 17 Left 1036567261 8:9948212-9948234 CCTGCTCTTCTCCTTGGACAATT No data
Right 1036567273 8:9948252-9948274 CCAACCCACACCACCCTGGGGGG No data
1036567260_1036567273 18 Left 1036567260 8:9948211-9948233 CCCTGCTCTTCTCCTTGGACAAT No data
Right 1036567273 8:9948252-9948274 CCAACCCACACCACCCTGGGGGG No data
1036567264_1036567273 6 Left 1036567264 8:9948223-9948245 CCTTGGACAATTCCGTTTGGGCC No data
Right 1036567273 8:9948252-9948274 CCAACCCACACCACCCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036567273 Original CRISPR CCAACCCACACCACCCTGGG GGG Intergenic
No off target data available for this crispr