ID: 1036569988

View in Genome Browser
Species Human (GRCh38)
Location 8:9971750-9971772
Sequence ATGGATAAACAGAATGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036569988_1036569991 13 Left 1036569988 8:9971750-9971772 CCTACCACATTCTGTTTATCCAT No data
Right 1036569991 8:9971786-9971808 GTCCAATGATATGAACATTTAGG No data
1036569988_1036569993 27 Left 1036569988 8:9971750-9971772 CCTACCACATTCTGTTTATCCAT No data
Right 1036569993 8:9971800-9971822 ACATTTAGGTTGTTTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036569988 Original CRISPR ATGGATAAACAGAATGTGGT AGG (reversed) Intergenic
No off target data available for this crispr