ID: 1036570533

View in Genome Browser
Species Human (GRCh38)
Location 8:9976359-9976381
Sequence CTGTAAATAAGGCCCTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036570525_1036570533 25 Left 1036570525 8:9976311-9976333 CCCAAATGATCACATATGGAAGT No data
Right 1036570533 8:9976359-9976381 CTGTAAATAAGGCCCTTCCAGGG No data
1036570529_1036570533 -7 Left 1036570529 8:9976343-9976365 CCCACGGGCAGATCTTCTGTAAA No data
Right 1036570533 8:9976359-9976381 CTGTAAATAAGGCCCTTCCAGGG No data
1036570524_1036570533 26 Left 1036570524 8:9976310-9976332 CCCCAAATGATCACATATGGAAG No data
Right 1036570533 8:9976359-9976381 CTGTAAATAAGGCCCTTCCAGGG No data
1036570530_1036570533 -8 Left 1036570530 8:9976344-9976366 CCACGGGCAGATCTTCTGTAAAT No data
Right 1036570533 8:9976359-9976381 CTGTAAATAAGGCCCTTCCAGGG No data
1036570523_1036570533 27 Left 1036570523 8:9976309-9976331 CCCCCAAATGATCACATATGGAA No data
Right 1036570533 8:9976359-9976381 CTGTAAATAAGGCCCTTCCAGGG No data
1036570526_1036570533 24 Left 1036570526 8:9976312-9976334 CCAAATGATCACATATGGAAGTG No data
Right 1036570533 8:9976359-9976381 CTGTAAATAAGGCCCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036570533 Original CRISPR CTGTAAATAAGGCCCTTCCA GGG Intergenic
No off target data available for this crispr