ID: 1036576799

View in Genome Browser
Species Human (GRCh38)
Location 8:10035130-10035152
Sequence GTGTCCATTATACCACTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036576799_1036576807 9 Left 1036576799 8:10035130-10035152 CCAGACAGTGGTATAATGGACAC No data
Right 1036576807 8:10035162-10035184 AGAAGGGGGAAGGGTAGAAGTGG No data
1036576799_1036576806 0 Left 1036576799 8:10035130-10035152 CCAGACAGTGGTATAATGGACAC No data
Right 1036576806 8:10035153-10035175 TGGAGACTCAGAAGGGGGAAGGG No data
1036576799_1036576803 -6 Left 1036576799 8:10035130-10035152 CCAGACAGTGGTATAATGGACAC No data
Right 1036576803 8:10035147-10035169 GGACACTGGAGACTCAGAAGGGG 0: 27
1: 97
2: 195
3: 277
4: 600
1036576799_1036576808 17 Left 1036576799 8:10035130-10035152 CCAGACAGTGGTATAATGGACAC No data
Right 1036576808 8:10035170-10035192 GAAGGGTAGAAGTGGAGATGAGG No data
1036576799_1036576804 -5 Left 1036576799 8:10035130-10035152 CCAGACAGTGGTATAATGGACAC No data
Right 1036576804 8:10035148-10035170 GACACTGGAGACTCAGAAGGGGG 0: 15
1: 67
2: 201
3: 374
4: 723
1036576799_1036576801 -8 Left 1036576799 8:10035130-10035152 CCAGACAGTGGTATAATGGACAC No data
Right 1036576801 8:10035145-10035167 ATGGACACTGGAGACTCAGAAGG 0: 25
1: 93
2: 259
3: 432
4: 1111
1036576799_1036576805 -1 Left 1036576799 8:10035130-10035152 CCAGACAGTGGTATAATGGACAC No data
Right 1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG No data
1036576799_1036576802 -7 Left 1036576799 8:10035130-10035152 CCAGACAGTGGTATAATGGACAC No data
Right 1036576802 8:10035146-10035168 TGGACACTGGAGACTCAGAAGGG 0: 25
1: 109
2: 278
3: 512
4: 1098

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036576799 Original CRISPR GTGTCCATTATACCACTGTC TGG (reversed) Intergenic
No off target data available for this crispr