ID: 1036576805

View in Genome Browser
Species Human (GRCh38)
Location 8:10035152-10035174
Sequence CTGGAGACTCAGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036576799_1036576805 -1 Left 1036576799 8:10035130-10035152 CCAGACAGTGGTATAATGGACAC No data
Right 1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036576805 Original CRISPR CTGGAGACTCAGAAGGGGGA AGG Intergenic
No off target data available for this crispr