ID: 1036577904

View in Genome Browser
Species Human (GRCh38)
Location 8:10045437-10045459
Sequence GTGTCTTTCAGGAGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036577896_1036577904 19 Left 1036577896 8:10045395-10045417 CCAGGGAGAAGAAAGAAGGAAAA No data
Right 1036577904 8:10045437-10045459 GTGTCTTTCAGGAGGGAAGCGGG No data
1036577895_1036577904 20 Left 1036577895 8:10045394-10045416 CCCAGGGAGAAGAAAGAAGGAAA No data
Right 1036577904 8:10045437-10045459 GTGTCTTTCAGGAGGGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036577904 Original CRISPR GTGTCTTTCAGGAGGGAAGC GGG Intergenic
No off target data available for this crispr