ID: 1036584076

View in Genome Browser
Species Human (GRCh38)
Location 8:10106882-10106904
Sequence TAGAGGGGTAGGCGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1442
Summary {0: 1, 1: 0, 2: 16, 3: 163, 4: 1262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036584076 Original CRISPR TAGAGGGGTAGGCGGGTGGA GGG (reversed) Intronic
900206060 1:1432386-1432408 GGGAGGGGTGGCCGGGTGGAGGG - Intergenic
900364110 1:2303816-2303838 TGGAGGGGCAGGCGGGTGTCGGG - Intronic
900498707 1:2989191-2989213 TAGATGGATGGGTGGGTGGATGG - Intergenic
900509522 1:3051903-3051925 TGGATGGGTGGGTGGGTGGATGG - Intergenic
900509541 1:3051989-3052011 TAGATGGGTGGGTGAGTGGATGG - Intergenic
900573412 1:3371201-3371223 TGGATGGGTGGGTGGGTGGATGG - Intronic
900650158 1:3726537-3726559 TGGATGGGTAGGTGGATGGATGG + Intronic
900650180 1:3726617-3726639 TAGACGGGTGGGTGGATGGATGG + Intronic
900650222 1:3726771-3726793 TGGATGGGTAGGTGGATGGATGG + Intronic
900650238 1:3726830-3726852 TAGATGGGTGGGTGGATGGATGG + Intronic
900993087 1:6106857-6106879 TGGAGGGGTGGAGGGGTGGAGGG + Intronic
900993110 1:6106921-6106943 TGGAGGGGTGGAGGGGTGGAGGG + Intronic
900993602 1:6108848-6108870 TAGAGGGATGGAGGGGTGGAAGG + Intronic
901134395 1:6983747-6983769 TAGAGGGTTGGGTGGGTAGATGG + Intronic
901134498 1:6984189-6984211 TAGAGGGATGGGTGGGTTGATGG + Intronic
901224800 1:7607094-7607116 TGGAGGAGTAGGTGGGTAGATGG + Intronic
901224824 1:7607194-7607216 TGGATGGGTAGGTGGATGGATGG + Intronic
901224853 1:7607305-7607327 TGGAATGGTAGGTGGGTGGATGG + Intronic
901262572 1:7885016-7885038 TGGATGGGTGGGTGGGTGGATGG - Intergenic
901317980 1:8321916-8321938 TGGATGGGTGGGTGGGTGGATGG + Intronic
901318070 1:8322224-8322246 TGGATGGGTGGGTGGGTGGATGG + Intronic
901489348 1:9588862-9588884 TAGGCGGGTAGGCGGGTAGGCGG - Intergenic
901489351 1:9588870-9588892 TAGGCGGGTAGGCGGGTAGGCGG - Intergenic
901489354 1:9588878-9588900 CAGGGGGGTAGGCGGGTAGGCGG - Intergenic
901700331 1:11041855-11041877 TAGAAGGATGGGTGGGTGGAAGG + Intronic
901740317 1:11338017-11338039 AAGAGGGGGAGGAGGGGGGAAGG - Intergenic
901831358 1:11894450-11894472 TGGATGGGTGGGTGGGTGGATGG + Intergenic
901863718 1:12090397-12090419 TAGATGGGTAGATGGATGGATGG - Intronic
902176165 1:14652673-14652695 TAGATGGATGGGTGGGTGGATGG - Intronic
902202682 1:14845418-14845440 TAGATGGGTGGGTGGATGGACGG + Intronic
902202709 1:14845548-14845570 TAGATGGGTGGGTGGATGGATGG + Intronic
902398040 1:16143038-16143060 TGGAGGGGTGGGCAGATGGATGG + Intronic
902412837 1:16221493-16221515 TAGACAGGCAGGTGGGTGGAGGG + Intergenic
902603902 1:17558205-17558227 TGGATGGGCAGGCGGATGGATGG - Intronic
902621843 1:17655372-17655394 TGGATGGGTGGGTGGGTGGATGG - Intronic
902655013 1:17860938-17860960 TAGATGGATAGGTGGGTGGATGG - Intergenic
902718282 1:18287825-18287847 CAGAGAGGGAGGCAGGTGGAAGG - Intronic
902784700 1:18725418-18725440 AGGAGGGGCAGGCGGGAGGAAGG - Intronic
902924120 1:19684494-19684516 CAGAGGGGTAGAGGGGTAGAGGG - Intronic
903175151 1:21576118-21576140 TAGACAGGCAGGTGGGTGGATGG + Intronic
903181043 1:21604978-21605000 TAGATGGGTAGGTGGGTGGATGG + Intronic
903277358 1:22230786-22230808 TGGATGGGTAGGTGGGTGGATGG - Intergenic
903277410 1:22230984-22231006 TGGATGGGTAGGTGGGTGGATGG - Intergenic
903277462 1:22231186-22231208 TGGATGGGTAGGTGGGTGGATGG - Intergenic
903287131 1:22284355-22284377 TAGATGGGTGAGTGGGTGGATGG - Intergenic
903287147 1:22284427-22284449 TAGATGGGTGGGTGGATGGATGG - Intergenic
903573981 1:24326405-24326427 TGGAGGGGAAGAGGGGTGGAGGG - Intronic
903664630 1:24998788-24998810 TAGAGGGCTGGGCAGGGGGAAGG - Intergenic
904487893 1:30839847-30839869 TAGGAGGATGGGCGGGTGGATGG + Intergenic
904487931 1:30839978-30840000 TAGATGGGTAGACAGGTGGGTGG + Intergenic
904487934 1:30839986-30840008 TAGACAGGTGGGTGGGTGGATGG + Intergenic
904541100 1:31234002-31234024 TATAAGGGTAGGTGAGTGGATGG - Intronic
904542138 1:31240028-31240050 GAGAGGGATAGGGAGGTGGAGGG + Intergenic
904582325 1:31553846-31553868 GAGTGGGGGAGGGGGGTGGAAGG - Intergenic
904594248 1:31633077-31633099 TAGGTGGGTAGGTGGGTGGGTGG - Intronic
905885515 1:41489741-41489763 TGGATGGGTAGACGGATGGATGG - Intergenic
906522222 1:46474377-46474399 TAGAGGGGTAGAGGGGTAGAGGG + Intergenic
906626828 1:47332536-47332558 TGGAGGGGTTGGAGGGTGGTGGG - Intergenic
908379967 1:63588374-63588396 TTCAGGGGTAGGAGGGAGGAGGG + Intronic
908647177 1:66290795-66290817 TTGAGGGGTAGCCTGGTGGGTGG - Intronic
908816328 1:68039277-68039299 TAGAGGGTTAGTCTGGTGTAGGG + Intergenic
909318004 1:74247990-74248012 CACGGGGGTAGGGGGGTGGAGGG + Intronic
911047776 1:93642777-93642799 GAGAGGCTTAGGTGGGTGGAGGG + Intronic
911115812 1:94246500-94246522 TGGAGGGGTTGGCGGGGGGAAGG - Intronic
912695069 1:111835239-111835261 TGGGTGGGTAGGCGGTTGGAGGG + Intronic
912699239 1:111864142-111864164 TGGAGGGGTGGGCGTGTGGAAGG + Intronic
913337116 1:117718600-117718622 TAGTGGGGTGGGAGGGTGGGAGG - Intergenic
913501771 1:119478317-119478339 CACATGGGTAGGTGGGTGGATGG + Intergenic
914196362 1:145450073-145450095 GAGAGCAGTCGGCGGGTGGACGG - Intergenic
914196375 1:145450136-145450158 GAGAGCAGTCGGCGGGTGGACGG - Intergenic
914196381 1:145450166-145450188 GAGAGCAGTCGGCGGGTGGACGG - Intergenic
914443563 1:147728985-147729007 TTGGGGAGTAGGGGGGTGGAGGG - Intergenic
916075360 1:161197362-161197384 TAGAGAGGGAGGAGGGAGGAGGG + Intronic
917233375 1:172862684-172862706 TAGATGGGTAGACAGATGGATGG - Intergenic
917869445 1:179229136-179229158 CCGAGGGGTCGGAGGGTGGAAGG - Intronic
918502911 1:185217978-185218000 TGGACGGGTAAGCGGGAGGATGG - Intronic
919519726 1:198572909-198572931 GAGAGGAGTAGGTGGGTGGGAGG + Intergenic
920113592 1:203603975-203603997 TGGATGGGTGGGTGGGTGGATGG - Intergenic
920113609 1:203604027-203604049 TGGATGGGTGGGTGGGTGGATGG - Intergenic
920811997 1:209294863-209294885 TGGATGGGTGGGTGGGTGGATGG + Intergenic
920942989 1:210501477-210501499 TAGAGGGGTGGTGGAGTGGAGGG + Intronic
922774474 1:228208416-228208438 TAGAGGGGACGGTGGGTGCAGGG - Intronic
924118877 1:240776422-240776444 GGGAGGGGTAGGAGGGTGGAGGG - Intronic
924423009 1:243926546-243926568 TGGAGGGGTGGGTGGGTGCAGGG - Intergenic
924559147 1:245143301-245143323 CAGACGGGTAGATGGGTGGATGG - Intergenic
924604410 1:245520596-245520618 TGGATGGGTGGGTGGGTGGATGG - Intronic
924626079 1:245697629-245697651 TAGAGGTGGAGGTGGGTGGTGGG + Intronic
1062943686 10:1444222-1444244 TAGATGGGTGGGTGGATGGATGG - Intronic
1062943752 10:1444559-1444581 TAGAGTGGTGGGTGGATGGATGG - Intronic
1062943855 10:1445081-1445103 TAGATGGGTGGGTGGGTGGATGG - Intronic
1062943872 10:1445181-1445203 TGGATGGGTTGGTGGGTGGATGG - Intronic
1062943893 10:1445270-1445292 TAGATGGGTGGGTGGGTGGATGG - Intronic
1063096696 10:2915214-2915236 TAGAGGGGTCGAGGGGTTGAGGG - Intergenic
1063096699 10:2915222-2915244 TAGAGGGGTAGAGGGGTCGAGGG - Intergenic
1063096702 10:2915230-2915252 TAGAGGAGTAGAGGGGTAGAGGG - Intergenic
1063119769 10:3097172-3097194 TAGGTAGGTAGGCGGGTGGGTGG - Intronic
1063140635 10:3253957-3253979 TAGGTGGGTAGATGGGTGGACGG - Intergenic
1063140721 10:3254305-3254327 TAGGTGGGTAGGTGGGTGGATGG - Intergenic
1063282198 10:4642435-4642457 TAGTGGGGTTGGGGGGTAGATGG + Intergenic
1063958312 10:11285091-11285113 TGGATGGGTGGGTGGGTGGATGG + Intronic
1064302459 10:14134565-14134587 TGGATGGGTAGGTGGGTAGATGG + Intronic
1064306372 10:14170785-14170807 AAGAGAGGTAGGGGAGTGGAAGG - Intronic
1064998484 10:21316609-21316631 TGGAGGTGTAAGCGGGTGGGAGG - Intergenic
1065633155 10:27702778-27702800 TGGAGGGGTGGGCGGGGGAAAGG + Intronic
1065780227 10:29160397-29160419 CAGAGGGGTAGGAGAGAGGAGGG + Intergenic
1066209701 10:33224709-33224731 TAGCGGGGTATGTGGGAGGACGG - Intronic
1066551840 10:36567554-36567576 TAGTGGGGTATGTGGGAGGAGGG - Intergenic
1067163733 10:43848526-43848548 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1067289132 10:44928670-44928692 TAAATGGATAGGTGGGTGGATGG - Intronic
1067289157 10:44928810-44928832 TGGATGGATAGGTGGGTGGATGG - Intronic
1067410084 10:46056420-46056442 TGGAGGCAAAGGCGGGTGGATGG + Intergenic
1067450446 10:46378923-46378945 TAGATGGATGGGTGGGTGGATGG + Intronic
1067556675 10:47277896-47277918 GAGAGGGGTAGGGGGGTGGCCGG + Intergenic
1067586796 10:47480828-47480850 TAGATGGATGGGTGGGTGGATGG - Intronic
1067659208 10:48221887-48221909 TAGATGGGTGGGTGAGTGGATGG + Intronic
1067659223 10:48221947-48221969 TAGGTGGGTGGGTGGGTGGATGG + Intronic
1067765194 10:49080602-49080624 GAGAGGGGCAGGTGTGTGGAAGG + Intronic
1067808233 10:49407896-49407918 TGGATGGATAGGTGGGTGGATGG + Intergenic
1068866201 10:61897723-61897745 AAAAGGGGTGGGGGGGTGGATGG + Intergenic
1069599868 10:69697091-69697113 TAGCTGGGTGGGCGGGTGCAGGG - Intergenic
1069890063 10:71646992-71647014 GAGAGGGGCAGGCGCCTGGAGGG + Intronic
1070557118 10:77537230-77537252 TAAAGGAGCAGGGGGGTGGAGGG - Intronic
1070696218 10:78565342-78565364 TCGATGGGTAGGCTGGTGGCTGG - Intergenic
1071338634 10:84622566-84622588 TAGATGGATAGATGGGTGGAGGG - Intergenic
1071508561 10:86247274-86247296 TAGATGGATAGACGGATGGATGG + Intronic
1071541431 10:86487943-86487965 TAGAGGGGTAGGTAGAGGGAAGG + Intronic
1073111698 10:101066542-101066564 CAGAGGGGTAGGCGGGGGTGGGG + Intronic
1073196893 10:101698817-101698839 CAGAGGCCAAGGCGGGTGGATGG - Intergenic
1074034534 10:109724955-109724977 TTGTGGGGTAGGGGGGTGGGAGG + Intergenic
1074350940 10:112736463-112736485 TAGATGGGTAGGTGGGTGGGTGG + Intronic
1075090745 10:119442875-119442897 TTGATAGGTAGGCGGGTGGGCGG + Intronic
1075090748 10:119442883-119442905 TAGGCGGGTGGGCGGGTGGATGG + Intronic
1075561456 10:123471563-123471585 TGGATGGGTTGGTGGGTGGATGG - Intergenic
1075685730 10:124364114-124364136 TAGAGGGGTGGGTGGGTGGAAGG - Intergenic
1076230405 10:128815915-128815937 TAGAAGGATAGAGGGGTGGATGG + Intergenic
1076359454 10:129876896-129876918 CAGAGGGGTAGCTGGGTGGGGGG - Intronic
1076458104 10:130617859-130617881 TAGAGGTGTAGGGTGGTGGTGGG + Intergenic
1076578073 10:131484071-131484093 TAGATGGATGGGTGGGTGGATGG + Intergenic
1076725147 10:132409641-132409663 TAGAGGTGTGGGTGGGTGGGTGG - Intronic
1076837457 10:133028378-133028400 TGGATGGGTAGGTGGATGGATGG + Intergenic
1076837473 10:133028430-133028452 TGGATGGGTAGGTGGATGGATGG + Intergenic
1076837494 10:133028510-133028532 TAGATGGGTAGATGGGTGGATGG + Intergenic
1076837513 10:133028562-133028584 TAAATGGGTGGGTGGGTGGATGG + Intergenic
1076837522 10:133028598-133028620 TAGATGGGTAGGTGGCTGGATGG + Intergenic
1076837542 10:133028662-133028684 TGGGTGGGTAGGTGGGTGGATGG + Intergenic
1076844933 10:133065402-133065424 TAGATGGGTGGGTGGGTGGGTGG + Intergenic
1076845335 10:133066702-133066724 TGGAGGGGTGGAGGGGTGGAGGG + Intergenic
1076845377 10:133066814-133066836 TGGAGGGGTGGAGGGGTGGAGGG + Intergenic
1076867353 10:133174617-133174639 TAGGTGGATAGGTGGGTGGATGG + Intronic
1076867594 10:133175667-133175689 AGGATGGGTAGGTGGGTGGATGG + Intronic
1076931821 10:133536734-133536756 TGGATGGGTGGGTGGGTGGATGG + Intronic
1076931834 10:133536770-133536792 TGGATGGGTGGGTGGGTGGATGG + Intronic
1076931852 10:133536818-133536840 TGGATGGGTGGGTGGGTGGATGG + Intronic
1076988407 11:256267-256289 TACATGGGTCGGTGGGTGGATGG + Intergenic
1077248533 11:1550692-1550714 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248567 11:1550818-1550840 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248601 11:1550936-1550958 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248636 11:1551062-1551084 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248709 11:1551318-1551340 GAGTGGGGTGGGCGGGTGGGTGG - Intergenic
1077248727 11:1551379-1551401 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248775 11:1551557-1551579 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248792 11:1551614-1551636 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248863 11:1551862-1551884 GAGTGGGGTGGGTGGGTGGATGG - Intergenic
1077248880 11:1551919-1551941 GAGTGGGGTGGGCGGGTGGATGG - Intergenic
1077266396 11:1652943-1652965 TGGAGGGCCAGCCGGGTGGAGGG + Intergenic
1077304224 11:1861668-1861690 TAGATGGGTGGATGGGTGGATGG + Intronic
1077312206 11:1893930-1893952 TAGATGGGTGGGTGGATGGATGG + Intergenic
1077312228 11:1894018-1894040 TGGATGGGTAGGTGGGTGGGTGG + Intergenic
1077319053 11:1932828-1932850 TGGATGGGTAGGTGGGTGGTTGG - Intronic
1077346026 11:2054427-2054449 GAGAGGCCAAGGCGGGTGGATGG - Intergenic
1077353156 11:2102234-2102256 TGGATGGGTAGGTGGGTGAATGG + Intergenic
1077357489 11:2125343-2125365 TAGATGAGTGGGTGGGTGGATGG + Intergenic
1077357621 11:2125995-2126017 TAGATGAGTGGGTGGGTGGATGG + Intergenic
1077357657 11:2126183-2126205 TAGATGAGTGGGTGGGTGGATGG + Intergenic
1077553506 11:3214855-3214877 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1077553513 11:3214871-3214893 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1077553523 11:3214899-3214921 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1077599776 11:3566178-3566200 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1077676245 11:4195465-4195487 TGGATGGATGGGCGGGTGGATGG - Intergenic
1077894793 11:6446144-6446166 TGGAGAGGAAGGAGGGTGGAAGG - Intergenic
1078083984 11:8222912-8222934 TAGAGGAGTAGGCCTGGGGAGGG + Intergenic
1078166956 11:8895246-8895268 TTGTGGGGTAGGGGGGTGGGAGG + Intronic
1078400541 11:11022700-11022722 TAGATGGGTGGGTGGGTGGGTGG - Intergenic
1078400551 11:11022728-11022750 TAGATGGGTGGGTGGGTGGATGG - Intergenic
1078540018 11:12205871-12205893 TGTAGGGGTAGGTGGGAGGAGGG + Intronic
1079424884 11:20330650-20330672 TAGAGGGAGAGGCAGGTGGAAGG - Intergenic
1080037358 11:27722884-27722906 TAGAGGGGGAGGCGGGAGGGGGG + Intergenic
1080559275 11:33447478-33447500 TAGATGGGTGGGTGGGTGGGTGG - Intergenic
1080578051 11:33617826-33617848 TGGATAGGTAGGTGGGTGGATGG + Intronic
1080578061 11:33617866-33617888 CAGATGGGTAGGTAGGTGGATGG + Intronic
1080749318 11:35138391-35138413 TAGATGGATGGGCGGATGGAAGG + Intergenic
1080826947 11:35856421-35856443 TAGATGGATGGGTGGGTGGACGG + Intergenic
1081615432 11:44587952-44587974 TGGAGGGGTAGGTAGGTGGATGG - Intronic
1081997060 11:47372568-47372590 TGGACGAGTAGGTGGGTGGATGG + Intronic
1083288136 11:61674163-61674185 TGGATGGATAGGCGGATGGATGG + Intergenic
1083715981 11:64577240-64577262 TAGATGGATGGGCGGGTGGACGG + Intergenic
1083716038 11:64577496-64577518 TGGATGGATAGGTGGGTGGATGG + Intergenic
1083841032 11:65304435-65304457 TGGATGGGTGGGTGGGTGGATGG - Intronic
1084033753 11:66495603-66495625 GAGAGGGGCAGGCAGGTGGCAGG - Intronic
1084255686 11:67940791-67940813 TAGGTGGGTAGGTGGGTGGATGG + Intergenic
1084303205 11:68264692-68264714 TGGATGGGTGGGTGGGTGGATGG - Intronic
1084393933 11:68896680-68896702 TGCAGGGGAAGGCGGGTGGGTGG + Intronic
1084413393 11:69016676-69016698 TAGATGGTTTGGTGGGTGGATGG - Intergenic
1084451798 11:69243422-69243444 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1084545581 11:69813585-69813607 TAGATGGGTGGGTGGATGGATGG + Intronic
1084547962 11:69823842-69823864 GAGAGGGGTAGGGGGGTGCAAGG - Intergenic
1084694857 11:70746987-70747009 TACAGGGGTAGGGGGGTGCAGGG - Intronic
1084699391 11:70776688-70776710 TAGGTGGGTAGGTGGGAGGATGG - Intronic
1084713545 11:70859295-70859317 TGGATGGGTAGGTGAGTGGAGGG + Intronic
1084781797 11:71414757-71414779 TGGATGGGTAGGTGGGTTGATGG + Intergenic
1084781841 11:71414963-71414985 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1084781857 11:71415038-71415060 TGGATGGGTGGGCGGATGGATGG + Intergenic
1084785746 11:71440708-71440730 TGAATGGGTAGGGGGGTGGATGG + Intronic
1084817066 11:71654527-71654549 TAGGTGGGTAGGTGGGTGGATGG - Intergenic
1085120172 11:73962454-73962476 TGGCTGGGTAGGCGGATGGATGG + Intronic
1085464272 11:76713493-76713515 TTGATGGGTGGGAGGGTGGATGG + Intergenic
1085464293 11:76713563-76713585 TAGATGGGTGGGTGGATGGATGG + Intergenic
1085528587 11:77178344-77178366 TGGATGGGTGGGTGGGTGGATGG - Intronic
1085776775 11:79373519-79373541 TACATGGGTGGGTGGGTGGATGG + Intronic
1088472218 11:110198679-110198701 GAGTGGGGTTGGGGGGTGGAGGG - Intronic
1088502021 11:110492171-110492193 TGGAGGGGTCCGCGGGAGGAGGG + Intergenic
1088799073 11:113289210-113289232 TAGTGGGGTAGGGGTGGGGAGGG - Intergenic
1089116456 11:116099167-116099189 TACTGGGGTAGGGGGGAGGATGG - Intergenic
1089322993 11:117639305-117639327 TGGATGGGTAGGAGGCTGGATGG + Intronic
1089404559 11:118186826-118186848 TACAGAGTTAGGTGGGTGGATGG - Intergenic
1089565272 11:119367973-119367995 TGGAGGAGGAGGCGGGAGGATGG + Intronic
1089988681 11:122837579-122837601 TAGATGGGTGGTTGGGTGGATGG + Intergenic
1090640668 11:128726522-128726544 TAGGGGGGTGGGAGGGTGGCAGG - Intronic
1090859790 11:130642880-130642902 TAGAGGGGTAGATAGATGGATGG - Intergenic
1090984965 11:131758260-131758282 TAGCGGGGTTGGCGGGGGGGAGG - Intronic
1091187325 11:133658362-133658384 TGGATGGGTAGAAGGGTGGATGG + Intergenic
1091195890 11:133730496-133730518 TAGAAGGGGAGGGGGGTGCAGGG - Intergenic
1091291108 11:134440374-134440396 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1091446202 12:545599-545621 TAGAGGGGTAGGGGTGAGGGAGG - Intronic
1091670033 12:2446264-2446286 TAAATGGATAGGTGGGTGGATGG + Intronic
1091985569 12:4908524-4908546 TTGAGGGATATGCGTGTGGAAGG + Intergenic
1092100597 12:5880809-5880831 TAGATGGGTGGGTGGATGGATGG + Intronic
1092100606 12:5880833-5880855 TAGATGGGTGGGTGGGTGGGTGG + Intronic
1092107613 12:5933495-5933517 TGGATGGGTGGGTGGGTGGATGG + Intronic
1092425922 12:8375517-8375539 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1094317322 12:29148794-29148816 TGGCGGGGTAGGGGGGTGGAGGG - Intergenic
1094819594 12:34214203-34214225 TGGAGGTGTGGGCGGGTGGTGGG + Intergenic
1095670518 12:44854701-44854723 TGGATGGGTGGGTGGGTGGATGG + Intronic
1095733912 12:45535844-45535866 TGGATGGATAGGTGGGTGGATGG - Intergenic
1095946885 12:47758758-47758780 TAGAGGGGTGGGGGCGTGGTGGG + Intronic
1096025578 12:48358272-48358294 CAGAAGGGTAGGAGGGTGGGAGG - Intergenic
1096104640 12:48989844-48989866 TAGATGGATGGGTGGGTGGATGG + Intergenic
1096355571 12:50938192-50938214 TAGGGGGGTGGGGGGGTGGAGGG - Intergenic
1096583602 12:52604217-52604239 TAGATGGGTGGGTGGGTAGATGG + Intergenic
1096850455 12:54432389-54432411 CAGAGGAGTAAGCGTGTGGATGG + Intergenic
1096950014 12:55458646-55458668 GAGAGGGGAGGGTGGGTGGAGGG + Intergenic
1097319858 12:58213358-58213380 TGGGGGGGCAGGGGGGTGGAGGG - Intergenic
1098243199 12:68488738-68488760 GAGAGGGGTAGGAGGGGGAAAGG + Intergenic
1098379096 12:69849903-69849925 TAGAAGGATATGTGGGTGGATGG + Intronic
1098504852 12:71237605-71237627 AAGAGGAGGAGGAGGGTGGATGG - Intronic
1098687426 12:73441785-73441807 TGGATGGGTAGGTGGATGGATGG - Intergenic
1100470456 12:94888367-94888389 TGGGGGGGTTGGCGGGGGGAGGG - Intergenic
1101094085 12:101318075-101318097 TGGTGGGGAAGGTGGGTGGAAGG - Intronic
1101417900 12:104524586-104524608 TAGAAGAGTAGGTGAGTGGATGG - Intronic
1101807967 12:108081520-108081542 TAGGTGGGTAGGTAGGTGGATGG - Intergenic
1101979528 12:109393567-109393589 TGGATGGGTGGGCGGATGGATGG - Intronic
1101979544 12:109393635-109393657 TGGATGGATAGGCGGATGGATGG - Intronic
1102043151 12:109813713-109813735 TAGATGGGTAGATGGATGGATGG + Intronic
1102260006 12:111437863-111437885 TGGAGGGTTTGCCGGGTGGATGG - Intronic
1102401052 12:112630136-112630158 TGGATGGGTGGGTGGGTGGATGG - Intronic
1102507170 12:113390885-113390907 TGGACGGGTGGGTGGGTGGATGG - Exonic
1102785888 12:115604599-115604621 TGGGTGGGTAGGTGGGTGGATGG + Intergenic
1102920636 12:116789154-116789176 TAGATGGATAGATGGGTGGATGG + Intronic
1102920762 12:116789683-116789705 TAGAGGGATGGATGGGTGGATGG + Intronic
1102920801 12:116789854-116789876 TAGATGGATAGATGGGTGGATGG + Intronic
1102927782 12:116839731-116839753 TAGATGGGTGGGTGGGTGAATGG + Intronic
1102981329 12:117243760-117243782 TGGATGGGTGGGTGGGTGGATGG - Intronic
1102981355 12:117243864-117243886 TAGATGGATAGGTGGGTGGGTGG - Intronic
1102986959 12:117286037-117286059 AAGAGGGGAAGGGGAGTGGATGG - Intronic
1102996250 12:117353048-117353070 TAGGTAGGTAGGTGGGTGGATGG - Intronic
1103004381 12:117409452-117409474 TAGAGGGATGGATGGGTGGATGG + Intronic
1103017755 12:117508867-117508889 TAGATGGATAGATGGGTGGATGG + Intronic
1103023465 12:117555096-117555118 GTGAGGGGTAGGAGGGAGGAAGG - Intronic
1103024032 12:117558879-117558901 TAAATGGGTAGGTGGATGGACGG + Intronic
1103045114 12:117729688-117729710 TGGATGGGTGGGTGGGTGGATGG - Intronic
1103908342 12:124338906-124338928 TAGCTGGGTGGGTGGGTGGATGG - Intronic
1103958532 12:124593219-124593241 GAGAGGGAAAGGCGGGTGGGTGG - Intergenic
1104092329 12:125527054-125527076 TAGAAGGGTAAATGGGTGGATGG - Intronic
1104092349 12:125527122-125527144 TAGAAGGGTAAATGGGTGGATGG - Intronic
1104092392 12:125527254-125527276 TAGAAGGGTAAACGGGTGGATGG - Intronic
1104092493 12:125527576-125527598 TAGAAGGGTAAACGGGTGGATGG - Intronic
1104334486 12:127880755-127880777 TAGGTGGGTAGGTGGATGGATGG - Intergenic
1104417132 12:128604965-128604987 TAGATGGGTAGATGGATGGACGG + Intronic
1104519668 12:129461718-129461740 TAGAGAGGTGGGTGGGTGGGTGG + Intronic
1104766059 12:131331070-131331092 TGGATAGGTAGGTGGGTGGATGG - Intergenic
1104778415 12:131404680-131404702 TGGATGGGTAGATGGGTGGATGG - Intergenic
1104778499 12:131405002-131405024 TGGATGGGTAGATGGGTGGATGG - Intergenic
1104778523 12:131405099-131405121 TAGATGGGTAGTTGGGTGGATGG - Intergenic
1104778537 12:131405150-131405172 TGGATGGGTAGATGGGTGGATGG - Intergenic
1104778543 12:131405170-131405192 TGGATGGGTAGATGGGTGGATGG - Intergenic
1104778583 12:131405321-131405343 TGGATGGGTAGATGGGTGGATGG - Intergenic
1104778613 12:131405411-131405433 TAGATGGGTGGATGGGTGGATGG - Intergenic
1104888123 12:132124085-132124107 TAGACAGGTAGGTGGGTGAATGG - Intronic
1104896089 12:132164548-132164570 TGGATGGGTGGGTGGGTGGACGG - Intergenic
1104925789 12:132313417-132313439 TGGATGGGTAGGTGGGTAGAAGG - Intronic
1104925863 12:132313666-132313688 TGGATGGGTGGGTGGGTGGATGG - Intronic
1104925872 12:132313690-132313712 TGGATGGGTAGGTGGGTGAATGG - Intronic
1104925881 12:132313722-132313744 TGGATGAGTAGGCAGGTGGATGG - Intronic
1104925920 12:132313854-132313876 TGGATGGGTGGGTGGGTGGATGG - Intronic
1104926019 12:132314188-132314210 TGGATGGGTGGGTGGGTGGATGG - Intronic
1104954469 12:132457588-132457610 TGGATGGGTGGGTGGGTGGACGG + Intergenic
1104968168 12:132518893-132518915 CAGACGGGTGGGTGGGTGGATGG - Intronic
1105279618 13:18955794-18955816 TAGATGGATAGGTGGGTGAATGG - Intergenic
1105300428 13:19129237-19129259 TGGAGGCCAAGGCGGGTGGATGG + Intergenic
1105733360 13:23243278-23243300 ATGAGGGGCAGGCGGGTGGCTGG - Intronic
1105865869 13:24458712-24458734 TAGTGAGTTAGGTGGGTGGAGGG + Intronic
1106552823 13:30786627-30786649 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1107216087 13:37920390-37920412 TGGAAGGGTGGGAGGGTGGAAGG - Intergenic
1108095687 13:46898172-46898194 TGGAGGGGTAGGAGGGTGGCAGG - Intergenic
1108391568 13:49952481-49952503 TAGAGTGGAAGGAGGGTGGGAGG + Intergenic
1109370823 13:61417073-61417095 GAGAGGGGTAGGGGGGTGAGGGG - Intronic
1109400421 13:61820354-61820376 TAGAGGGGAAGGGGGAAGGAGGG + Intergenic
1109995809 13:70124474-70124496 TAAATAGGTAGGAGGGTGGACGG + Intergenic
1110495884 13:76167342-76167364 TAGAGGGTTATGTGGATGGAAGG - Intergenic
1113179659 13:107610979-107611001 TAGATGAGTAGGAAGGTGGAAGG + Intronic
1113641495 13:111960724-111960746 TAGAGGGATAGATGGATGGATGG + Intergenic
1113780161 13:112972238-112972260 TAGATGGGTGGGTGGGTGGATGG + Intronic
1113924334 13:113931950-113931972 CAGAGGAGCAGGAGGGTGGAGGG - Intergenic
1113935079 13:113989649-113989671 TGGATGGGTAGATGGGTGGATGG - Intronic
1114663553 14:24366202-24366224 GAGAGGGGAAGGCGGTTGGCTGG + Intronic
1114712763 14:24795055-24795077 GAGAGGGGTGGGGGGTTGGAGGG - Intergenic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1117548678 14:56812588-56812610 CAGAGGGGAAGGCCGGAGGAAGG + Intergenic
1118332789 14:64826765-64826787 TAGACGGGCAGGTGGATGGATGG - Intronic
1118722246 14:68602464-68602486 TAGATGGGTGGGTGGGTGGATGG + Intronic
1119703027 14:76768174-76768196 TACAGGGGTGGGGAGGTGGAAGG - Intronic
1119715602 14:76856904-76856926 TAGATGGGTGGGTGAGTGGATGG + Intronic
1121096569 14:91221526-91221548 TGGTTGGGTAGGTGGGTGGATGG + Intronic
1121225947 14:92322401-92322423 TACAGGTGCAGGCAGGTGGAGGG - Intergenic
1121254501 14:92521265-92521287 TGGAAGGGTAGGTGAGTGGATGG - Intronic
1121277432 14:92677864-92677886 TAGATGGATAGGTGGGTGGATGG - Intronic
1121277620 14:92678658-92678680 TGGATGGGTGGACGGGTGGATGG - Intronic
1121472757 14:94168049-94168071 TAGATGGGTGGGTGGGGGGACGG - Intronic
1121604869 14:95233339-95233361 TGGATGGGTAGGTGGATGGATGG - Intronic
1122011514 14:98752966-98752988 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1122134883 14:99627124-99627146 TGGATGGGTAGGTGGGTGGATGG - Intergenic
1122636934 14:103134460-103134482 TAGACGGGTGGGTGGGTGGGTGG - Intronic
1122741824 14:103875930-103875952 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1122813158 14:104298932-104298954 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1122813262 14:104299348-104299370 TAGATGGGTAGATGGATGGATGG - Intergenic
1122877559 14:104675839-104675861 TAGATGGGTAGGCGAATGAATGG + Intergenic
1122879974 14:104686298-104686320 TGGGTGGGTAGGTGGGTGGATGG + Intergenic
1122923575 14:104889967-104889989 TAGGAGGGTGGGTGGGTGGATGG + Intronic
1122923619 14:104890095-104890117 TAGGTGGGTGGGTGGGTGGATGG + Intronic
1122923652 14:104890195-104890217 TAGGTGGGTGGGTGGGTGGATGG + Intronic
1122923664 14:104890235-104890257 TAGGAGGGTGGGTGGGTGGATGG + Intronic
1122923743 14:104890551-104890573 TAGGTGGGTGGGTGGGTGGATGG + Intronic
1122923843 14:104890938-104890960 TGGATGGGTGGGTGGGTGGATGG + Intronic
1122958383 14:105083333-105083355 TAGAGTGGTGGGTGGATGGATGG - Intergenic
1122958427 14:105083480-105083502 TAGAGTGGTGGGTGGATGGATGG - Intergenic
1122958468 14:105083634-105083656 TAGAGTGGTGGGTGGATGGATGG - Intergenic
1122958586 14:105084088-105084110 TAGAGGGATGGGTGGGTGGATGG - Intergenic
1123436622 15:20259255-20259277 TAGAGGCCAAGGCAGGTGGATGG + Intergenic
1123587198 15:21771238-21771260 TAGATGGGTGGGTGGATGGATGG + Intergenic
1123623836 15:22213803-22213825 TAGATGGGTGGGTGGATGGATGG + Intergenic
1125019621 15:34971841-34971863 CAGAGGGTTGGGTGGGTGGAGGG - Intergenic
1125226892 15:37405647-37405669 TGGAGGTGGAGGCTGGTGGAAGG - Intergenic
1125411373 15:39409427-39409449 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1126354610 15:47782249-47782271 AGTAGGGGTAGGTGGGTGGATGG - Intergenic
1126476028 15:49065983-49066005 TGGAGGCTGAGGCGGGTGGATGG + Intergenic
1127658581 15:61078787-61078809 TAGGTGGGTGGGTGGGTGGATGG - Intronic
1128755763 15:70182611-70182633 GAAAGGGGTGGGTGGGTGGATGG + Intergenic
1128758997 15:70202600-70202622 TAGATGGGTAGGTGGAAGGATGG - Intergenic
1128793596 15:70449800-70449822 TAGAGGGATGGTTGGGTGGAGGG + Intergenic
1128817751 15:70626534-70626556 CAGAAGGGTGGGAGGGTGGAAGG + Intergenic
1129603251 15:77012389-77012411 TAGATGGGTGGGTGGGTGGATGG - Intronic
1129603263 15:77012421-77012443 TAGATGGGTGGGTGGATGGATGG - Intronic
1129603274 15:77012453-77012475 TAGATGGGTGGGTGGATGGATGG - Intronic
1130380941 15:83371923-83371945 TAGAGGGGTGGGGGAGTGGGCGG + Intergenic
1130821952 15:87505163-87505185 TAGATGGGTGGGTGGGTGGGGGG + Intergenic
1130868626 15:87952848-87952870 TAGAGGGGGCGGCGGGGGTAGGG - Intronic
1131283251 15:91038010-91038032 TAGAGGGGAAGGAGGGAGGGAGG + Intergenic
1131643543 15:94317637-94317659 TGGGAGGGTAGGAGGGTGGAAGG - Intronic
1131714602 15:95094801-95094823 TGGAGGGGTGGAGGGGTGGAGGG - Intergenic
1132255420 15:100372869-100372891 GGGAGGGGTTGGGGGGTGGAAGG + Intergenic
1132265917 15:100470529-100470551 TGGAGTGGGAGGCTGGTGGAAGG + Intronic
1132351437 15:101141998-101142020 TAGATGGGTAGATGGGTGGATGG - Intergenic
1132351471 15:101142134-101142156 TGGATGGATAGGTGGGTGGATGG - Intergenic
1132644954 16:994488-994510 TGGATGGGTAGGTGGGTGGGTGG - Intergenic
1132653861 16:1033545-1033567 TGGATGGATAGGTGGGTGGATGG - Intergenic
1132653901 16:1033730-1033752 TGGATGGATAGGTGGGTGGATGG - Intergenic
1132653911 16:1033765-1033787 TAGATGGGTGGACTGGTGGATGG - Intergenic
1132653934 16:1033880-1033902 TAGATGGATAGACTGGTGGATGG - Intergenic
1132711980 16:1272867-1272889 TAGATGGGTGGGTGGGTGGACGG + Intergenic
1132998237 16:2835249-2835271 TAGATGGGTGGGCGGGTGGATGG + Intronic
1133069397 16:3235576-3235598 TGGCGGGGTAGGGGGGTGGCGGG - Intronic
1133111714 16:3551831-3551853 TGGATGGGTAGGCAGGTGGATGG - Intronic
1133242903 16:4426169-4426191 TGCAGGGGTAGTGGGGTGGAGGG + Intronic
1133372429 16:5255396-5255418 TAGATGGGTAGGTGGGTGGATGG - Intergenic
1133383092 16:5347632-5347654 TAGATGGGTAGATGGGTGGGTGG - Intergenic
1133383226 16:5348118-5348140 TGGATGGATAGGTGGGTGGATGG - Intergenic
1133399460 16:5473987-5474009 TAGATGGATAGGTGGATGGATGG + Intergenic
1133456125 16:5943959-5943981 TGGATGGGTGGGGGGGTGGATGG - Intergenic
1133462754 16:6001042-6001064 TGGATGGGTAGGTGGGTTGATGG + Intergenic
1133495704 16:6315268-6315290 TGGATGGGTAGGTGGGTGGATGG + Intronic
1133495718 16:6315323-6315345 TAGATGGGTGGATGGGTGGACGG + Intronic
1133509472 16:6443751-6443773 TAGATGGGTAGATGGGTAGATGG - Intronic
1133530872 16:6653771-6653793 TGGATGGATAGGTGGGTGGATGG + Intronic
1133898263 16:9949601-9949623 TGGATGGGTAGACGGGTGGGTGG + Intronic
1133898291 16:9949734-9949756 TGGATGGGTGGGTGGGTGGATGG + Intronic
1134106968 16:11492266-11492288 TAGATGGGTGGGTGGGTGGGTGG - Intronic
1134112502 16:11524152-11524174 TTGGGGGGTTGGGGGGTGGATGG - Intergenic
1134197534 16:12170458-12170480 CAGTGGGGGAGGCGTGTGGATGG + Intronic
1134224664 16:12381183-12381205 TAGGTGGGTCGGTGGGTGGATGG - Intronic
1134446970 16:14338320-14338342 TGAATGGGTAGGTGGGTGGATGG - Intergenic
1134446977 16:14338344-14338366 TGGATGGATAGGTGGGTGGATGG - Intergenic
1134446993 16:14338404-14338426 TGGATGGGTAGGTGGGTGGATGG - Intergenic
1134447014 16:14338468-14338490 TAGGTGGGTAGGTGGATGGATGG - Intergenic
1134447024 16:14338504-14338526 TGGATGGATAGGTGGGTGGATGG - Intergenic
1134636963 16:15800005-15800027 TAGATGGGTAGGTAGATGGATGG + Intronic
1134746661 16:16593916-16593938 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1134766879 16:16767019-16767041 TAGATGAGTAGGTGGATGGATGG - Intergenic
1134766903 16:16767159-16767181 TAGATGGATGGGTGGGTGGATGG - Intergenic
1134998815 16:18759764-18759786 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1135114288 16:19712328-19712350 TAGAGGGGGAGGGGAGTGGAGGG - Intronic
1135135712 16:19884506-19884528 TAGAGGGGTGGGCGGGGGAGGGG - Intronic
1135524307 16:23202325-23202347 TAGATGGGTAGGTGGATGGATGG + Intronic
1135614210 16:23896944-23896966 TAGATGGGTGGGTGGATGGATGG - Intronic
1135793227 16:25417763-25417785 TGGAGAGGTAGGTGGATGGATGG - Intergenic
1135828695 16:25754320-25754342 TGGATGGGTGGGTGGGTGGATGG - Intronic
1135828841 16:25755036-25755058 TGGATGGATAGGTGGGTGGATGG - Intronic
1135828853 16:25755112-25755134 TGGAGGGGTGGAGGGGTGGAAGG - Intronic
1136024125 16:27459121-27459143 TGGATGGGTAGGTGGGTGGATGG + Intergenic
1136077645 16:27827981-27828003 CAGACGGGTAGGTGGATGGATGG - Intronic
1136290877 16:29270676-29270698 TAGGTGGGTAGGTGGATGGATGG + Intergenic
1137561767 16:49506910-49506932 TAGATGGATTGGTGGGTGGATGG + Intronic
1137821992 16:51454983-51455005 TAGATGAGTGGGTGGGTGGATGG + Intergenic
1138547677 16:57729391-57729413 TGGATGAGTGGGCGGGTGGATGG + Intronic
1138547759 16:57729668-57729690 TGGATGGGTGGGTGGGTGGATGG + Intronic
1138547830 16:57729935-57729957 TGGATGGGTGGGTGGGTGGATGG + Intronic
1138547884 16:57730158-57730180 TGGATGAGTAGGTGGGTGGATGG + Intronic
1138547918 16:57730290-57730312 TGGATGGGTGGGTGGGTGGATGG + Intronic
1139129069 16:64118549-64118571 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1139364194 16:66423555-66423577 TGGATGGGTAGGTGGGTAGATGG + Intergenic
1139493966 16:67302681-67302703 TAAAAGGGAAGGAGGGTGGATGG - Intronic
1140205917 16:72933319-72933341 CAGAGGAGTAGGAAGGTGGAGGG + Intronic
1141048918 16:80743027-80743049 TGGGTGGGTAGGTGGGTGGATGG + Intronic
1141110091 16:81265281-81265303 TGGATGGGTAGGTGGGTGAATGG - Intronic
1141145737 16:81528955-81528977 TGGAGGGATGGGTGGGTGGATGG - Intronic
1141163708 16:81646229-81646251 TGGATGGGTGGGCGGGTGGGTGG + Intronic
1141178046 16:81733573-81733595 TAGATGGATAGGTGGGTGGATGG - Intergenic
1141297239 16:82781564-82781586 TAAGTGGGTAGGTGGGTGGATGG - Intronic
1141391364 16:83667400-83667422 TGGATGGGTAGGTGGGTGGATGG - Intronic
1141421546 16:83921051-83921073 TAGATGGCTGGGTGGGTGGAAGG + Exonic
1141430346 16:83967963-83967985 TGGACGGGTAGGCAGGTGGATGG + Intergenic
1141483876 16:84325946-84325968 TAGATGGGTGGATGGGTGGATGG - Intronic
1141483879 16:84325954-84325976 TGGATGGGTAGATGGGTGGATGG - Intronic
1141483904 16:84326085-84326107 TAGATGGGTGGGTGGATGGACGG - Intronic
1141488230 16:84355098-84355120 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1141619058 16:85227121-85227143 CAGATGGGTGGGCGGATGGATGG - Intergenic
1141658073 16:85426632-85426654 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1141658089 16:85426691-85426713 TAGATGGGTGGGTGGATGGATGG + Intergenic
1141782962 16:86176675-86176697 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1141819850 16:86437767-86437789 TAGATGGTTGGGTGGGTGGAAGG - Intergenic
1141943534 16:87294445-87294467 CAGATGGATAGGTGGGTGGATGG + Intronic
1142083382 16:88163163-88163185 TGGATGGGTAGACGGATGGATGG + Intergenic
1142096754 16:88244174-88244196 TAGGTGGGTAGGTGGATGGATGG + Intergenic
1142124200 16:88402080-88402102 TAGATGGATGGGTGGGTGGATGG + Intergenic
1142128667 16:88422429-88422451 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1142128703 16:88422546-88422568 TGGGGGGATGGGCGGGTGGATGG + Intergenic
1142128818 16:88423030-88423052 TGGATGGGTAGGTGGGTGGATGG + Intergenic
1142128867 16:88423216-88423238 TGGATGGATAGGTGGGTGGATGG + Intergenic
1142128886 16:88423284-88423306 TGGATGGATAGGTGGGTGGATGG + Intergenic
1142152147 16:88517327-88517349 TGGGTGGGTAGGTGGGTGGATGG + Intronic
1142152958 16:88520794-88520816 TAGATGGATGGGTGGGTGGATGG + Intronic
1142161887 16:88562011-88562033 TAGAGGGGTGGGGGGGTGGGGGG - Intergenic
1142248445 16:88980264-88980286 TAGATGGGTGGATGGGTGGATGG + Intergenic
1142248626 16:88980956-88980978 TAGAGGGGTGGGTGGATGGGTGG + Intergenic
1142354931 16:89597797-89597819 CAGATGGGTGGGCGGGGGGATGG - Intergenic
1142354943 16:89597825-89597847 CAGATGGGTGGGCGGGGGGATGG - Intergenic
1142597599 17:1037103-1037125 TGGATGGGTGGGTGGGTGGATGG - Intronic
1142846312 17:2679591-2679613 TAGATGGGTGGGTGGGTGGATGG + Intronic
1143093329 17:4462713-4462735 TGGATGGGTGGGTGGGTGGATGG - Intronic
1143146805 17:4781923-4781945 CTGAGGGGTAGGCGGGTGAAGGG - Intronic
1143152301 17:4815174-4815196 TAGGAGGGTAGGCAGGTAGATGG + Intronic
1143264087 17:5622764-5622786 TGGTTGGGTAGGTGGGTGGATGG - Intergenic
1143709424 17:8724120-8724142 TAGAGGCCAAGGTGGGTGGATGG - Intergenic
1143710048 17:8728139-8728161 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1143804333 17:9413986-9414008 CAGATGGGTAGGTGGGTGGATGG - Intronic
1143851851 17:9818757-9818779 TAGAGGTGGAGGCTGGTGGGAGG - Intronic
1144103967 17:11969578-11969600 TAGAGGGACAGGTGGGTGAAGGG + Exonic
1145240028 17:21235771-21235793 TGGATGAGTAGGTGGGTGGATGG - Intergenic
1145240049 17:21235847-21235869 TAGATGGGTGGATGGGTGGATGG - Intergenic
1145240052 17:21235855-21235877 TGGATGGGTAGATGGGTGGATGG - Intergenic
1145240057 17:21235871-21235893 TAGATGGGTGGGTGGATGGATGG - Intergenic
1145240429 17:21237867-21237889 TGGATGGGTAAGTGGGTGGATGG - Intergenic
1145271497 17:21407236-21407258 TAGAGGGATGGAAGGGTGGATGG - Intronic
1145271540 17:21407439-21407461 TAGAGGGATGGCTGGGTGGATGG - Intronic
1145271582 17:21407611-21407633 TGGAGGGATAGGTGGGTGAATGG - Intronic
1145309711 17:21694684-21694706 TAGAGGGATGGAAGGGTGGATGG - Intronic
1145309754 17:21694887-21694909 TAGAGGGATGGCTGGGTGGATGG - Intronic
1145877429 17:28330336-28330358 TAGAGGGGTAGAGGGCTGGGTGG - Intronic
1146290970 17:31606980-31607002 TAGCGGGGTGGGTGGGTGGATGG - Intergenic
1146317599 17:31820441-31820463 GAGAGGCCGAGGCGGGTGGATGG + Intergenic
1146504734 17:33395040-33395062 TGGATGGGTAGGTGGATGGAAGG - Intronic
1147390709 17:40107562-40107584 TAGAGGGCCAGGCAGATGGAAGG + Intergenic
1147421004 17:40322157-40322179 GAGAAGGGGAGGGGGGTGGAGGG + Intronic
1147534081 17:41307189-41307211 CAGAGGGATGGGTGGGTGGATGG + Intergenic
1148160814 17:45449286-45449308 TAGATGGGTAGATGGGTGGACGG - Intronic
1148191478 17:45681552-45681574 TAGTGTGGGAGGTGGGTGGAGGG - Intergenic
1148331898 17:46818375-46818397 AGGAGGGGTGGGCGGGTGGGGGG + Intronic
1148346042 17:46904245-46904267 TGGATGGGTAGGTGGGTGGATGG + Intergenic
1148661670 17:49338980-49339002 GAGAGGAGGAGGCTGGTGGAAGG - Intronic
1149646322 17:58244217-58244239 TGGAGGGCTAGGAGGATGGAAGG - Intronic
1150081286 17:62241747-62241769 TAGTGGGGTAGGGGGATGTATGG + Intergenic
1150096272 17:62378763-62378785 TTGGGGGGTAGGGGGGTGGGGGG + Intronic
1150392100 17:64796156-64796178 TAGATGGGTAGATGGGTGGATGG - Intergenic
1150439159 17:65177460-65177482 TAGATGCGTGGGTGGGTGGATGG - Intronic
1150444899 17:65221236-65221258 GAGAGAGGTAGGAGGGTGGGAGG + Intronic
1150479764 17:65500048-65500070 TAGAGTGGTAGGGTGGTGGAAGG + Intergenic
1151286182 17:73113329-73113351 AAGAAGGGTAGGAGGGAGGAAGG - Intergenic
1151943324 17:77306058-77306080 TGGAGGGGTGGTGGGGTGGATGG + Intronic
1152141600 17:78540408-78540430 TAGATGGGTGAGTGGGTGGATGG + Intronic
1152232428 17:79120691-79120713 TAGATGGGTGGGTGGGTGGGTGG + Intronic
1152232437 17:79120715-79120737 TGGAAGGGTGGGTGGGTGGATGG + Intronic
1152237156 17:79144546-79144568 GAGAGGAGTTGGTGGGTGGAGGG + Intronic
1152301639 17:79498437-79498459 TAGATGGATGGGTGGGTGGAAGG - Intronic
1152301713 17:79498751-79498773 TGGATGGGTAGGCAGATGGATGG - Intronic
1152301812 17:79499260-79499282 TAGATGGGTGGGTGGTTGGATGG - Intronic
1152311287 17:79551528-79551550 TGGACGGGTGGGTGGGTGGATGG + Intergenic
1152312513 17:79559656-79559678 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1152312547 17:79559780-79559802 TGGATGGGTAGGTGGGTGGATGG + Intergenic
1152473524 17:80503384-80503406 TGGAGGGGTAGAGGGGTGGATGG + Intergenic
1152473544 17:80503452-80503474 TGGAGGGGTAGAGGGGTGGATGG + Intergenic
1152473631 17:80503762-80503784 TGGAGGGGTGGGTGGATGGATGG + Intergenic
1152615557 17:81336329-81336351 TAGATGGGTGGGTGGGTGGGTGG - Intergenic
1152767180 17:82147924-82147946 TGGATGGGTGGGTGGGTGGATGG + Intronic
1152767213 17:82148039-82148061 TGGATGGGTGGGTGGGTGGATGG + Intronic
1152767264 17:82148235-82148257 TAGATGGGTAGATGGATGGATGG + Intronic
1152767292 17:82148338-82148360 TGGATGGATAGGTGGGTGGATGG + Intronic
1152767315 17:82148410-82148432 TGGATGGATAGGTGGGTGGATGG + Intronic
1152767428 17:82148804-82148826 TGGATGGGTGGGTGGGTGGATGG + Intronic
1152767465 17:82148929-82148951 TGGATGGGTGGGTGGGTGGATGG + Intronic
1152767548 17:82149230-82149252 TAGATGGGTAGATGGATGGATGG + Intronic
1152875511 17:82784447-82784469 TTGAAGGGTACGGGGGTGGAGGG + Intronic
1152901937 17:82947323-82947345 CAGAGGGGTGGGTGTGTGGAGGG - Intronic
1153793880 18:8604969-8604991 GAGAGGCGGAGGCAGGTGGATGG + Intergenic
1153944661 18:10008418-10008440 TAGGTGGGTAGGTGGGTGGATGG - Intergenic
1153944684 18:10008495-10008517 TAGATGGGTGGGTGGGTGCATGG - Intergenic
1154307843 18:13243656-13243678 TGGATGGGTAGACGGATGGATGG - Intronic
1154307874 18:13243770-13243792 TGGATGGGTAGACGGATGGATGG - Intronic
1154307910 18:13243935-13243957 TGGATGGGTGGGTGGGTGGATGG - Intronic
1154307977 18:13244199-13244221 TGGATGGGTAGGTGGATGGATGG - Intronic
1154425955 18:14272238-14272260 TAGAATGGTGGGCAGGTGGAGGG + Intergenic
1154945292 18:21156931-21156953 TGGTGGGGTAGGCAGGTGGATGG + Intergenic
1155883814 18:31183320-31183342 TAGAGGGGTAGGAAGGAAGAGGG - Intergenic
1155892022 18:31282009-31282031 TTGATGGGCAGGTGGGTGGAGGG + Intergenic
1155980723 18:32176884-32176906 TGGATGGGTAGATGGGTGGATGG - Intronic
1155980732 18:32176920-32176942 TGGATGGGTAGATGGGTGGATGG - Intronic
1155980741 18:32176956-32176978 TGGATGGGTAGATGGGTGGATGG - Intronic
1156477129 18:37412605-37412627 TGGATGGGTGGGTGGGTGGATGG + Intronic
1157136692 18:45063517-45063539 TAGAGGGGGTGGCGGGGGCAGGG - Exonic
1157299895 18:46472071-46472093 TAGATGGGTGGGTGGATGGATGG - Intergenic
1157299988 18:46472423-46472445 TAGATGGGTGGGTGGGTGGATGG - Intergenic
1157300003 18:46472459-46472481 TGGATGGGTAGGTGGGTGGATGG - Intergenic
1157517324 18:48320285-48320307 TAGATGGGTAGGTGGGAAGATGG + Intronic
1157554278 18:48603092-48603114 TAGATGGGTGGGTGGGTGAATGG + Intronic
1157554368 18:48603472-48603494 TAGATGGGTGGGTGGGTGGGTGG + Intronic
1157592920 18:48846568-48846590 TGGATGGGTAGGTGGGTGGGTGG + Intronic
1158123689 18:54078816-54078838 TAGAAGGGTAGGAGGGTGGGAGG - Intergenic
1159325792 18:66915400-66915422 TAGTTGGGGAGGAGGGTGGAGGG + Intergenic
1159686983 18:71434769-71434791 TAGTGGTGGAGGTGGGTGGAGGG + Intergenic
1159754221 18:72343677-72343699 TGGAGGGGTAGGGGGAAGGATGG + Intergenic
1160297296 18:77650287-77650309 TAGATGGGTGGGTGGGTGGATGG - Intergenic
1160409749 18:78667731-78667753 GAGAGGGGTGGGAGGGCGGATGG - Intergenic
1160409759 18:78667754-78667776 GGGAGGGGTGGGAGGGTGGATGG - Intergenic
1160409778 18:78667796-78667818 GGGAGGGGTGGGAGGGTGGATGG - Intergenic
1160479696 18:79227404-79227426 TGGATGGGTGGGCGGGTGGGTGG + Intronic
1160526584 18:79542199-79542221 TAGATGGGTGGGTGGGTGGATGG - Intergenic
1160526592 18:79542223-79542245 TAAATGGGTAGGGGGATGGATGG - Intergenic
1160687155 19:442424-442446 TGGATGGATGGGCGGGTGGATGG + Intronic
1160687191 19:442532-442554 TGGATGGGTGGGTGGGTGGATGG + Intronic
1160687198 19:442548-442570 TGGATGGGTGGGTGGGTGGACGG + Intronic
1160687293 19:442832-442854 TGGATGGGTGGACGGGTGGACGG + Intronic
1160692161 19:465140-465162 TGGATGGGTGGGTGGGTGGATGG + Intronic
1160692247 19:465464-465486 TAGATGGGTGGGTGGGTGGATGG + Intronic
1160692264 19:465528-465550 TAGATGGGTAGGTGGGTGGATGG + Intronic
1160692274 19:465572-465594 TAGATGGGCAGGCAGGTGGGTGG + Intronic
1160692332 19:465790-465812 CAGATGGGTAGGTGGGTGGATGG + Intronic
1160692397 19:466023-466045 TAGATGGATGGGTGGGTGGATGG + Intronic
1160692422 19:466114-466136 TAGATGGGTGGGTGGGTGGATGG + Intronic
1160692464 19:466272-466294 TGGATGGGTGGGTGGGTGGATGG + Intronic
1160692487 19:466351-466373 TAGATGGGTGGGTGGGTGGGTGG + Intronic
1160692512 19:466446-466468 TGGATGGGTGGGTGGGTGGATGG + Intronic
1160692562 19:466651-466673 TGGGTGGGTAGGTGGGTGGATGG + Intronic
1160767834 19:816325-816347 TGGATGGGTGGGTGGGTGGATGG - Intronic
1160767861 19:816418-816440 TAGATGGGTGGGTGGGTGCATGG - Intronic
1160767867 19:816434-816456 TGGATGGGTAGGTGGGTAGATGG - Intronic
1160767978 19:816920-816942 TGGATGGGTGGGTGGGTGGATGG - Intronic
1160768007 19:817011-817033 TAGATGGGTAGGTTGGTAGATGG - Intronic
1160783597 19:889564-889586 GAGAGGGGCTGGCGGGTGGCTGG + Intronic
1160811834 19:1016193-1016215 ATGAGGGGTGGGCGGGGGGAGGG + Intronic
1160926722 19:1550076-1550098 TAGATGGGTGGGTGGATGGATGG - Intergenic
1160926767 19:1550236-1550258 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1160960135 19:1717251-1717273 TGGATGGATAGGTGGGTGGATGG + Intergenic
1160960177 19:1717409-1717431 TGGATGGATAGGTGGGTGGATGG + Intergenic
1160960186 19:1717466-1717488 TAGATGGATAAGTGGGTGGATGG + Intergenic
1160960233 19:1717678-1717700 CAGAGGGGTGGGAGGATGGATGG + Intergenic
1160977818 19:1802393-1802415 TGGGTGGGTAGGTGGGTGGATGG - Intronic
1161049675 19:2156507-2156529 TGGATGGGTGGGTGGGTGGATGG - Intronic
1161049865 19:2157545-2157567 TAGATGGGTAGATGGATGGATGG - Intronic
1161049886 19:2157617-2157639 TGGATGGGTGGGTGGGTGGATGG - Intronic
1161090288 19:2356801-2356823 TAAATGGGTGGGTGGGTGGATGG - Intergenic
1161090369 19:2357187-2357209 TGGGTGGGTGGGCGGGTGGATGG - Intergenic
1161197064 19:2992792-2992814 AAGGGGGGGAGGCGGGTGGGGGG + Intronic
1161227625 19:3154438-3154460 TAGATGGGTAGATGGATGGATGG + Intronic
1161242735 19:3231550-3231572 TAGATGGGTGGGTGGATGGATGG + Intronic
1161242743 19:3231582-3231604 TAGATGGGTGGGTGGATGGATGG + Intronic
1161243390 19:3235491-3235513 TAGATGGGTGGGTGGGTGGATGG + Intronic
1161258404 19:3322341-3322363 TAGATGGGTGGGCAGGTGGGTGG + Intergenic
1161258507 19:3322852-3322874 TAGAGGGATGGATGGGTGGATGG + Intergenic
1161258555 19:3323052-3323074 TAGAGGGATGGATGGGTGGATGG + Intergenic
1161265962 19:3364751-3364773 TACAGGGGAGGGAGGGTGGAAGG + Intronic
1161287546 19:3476783-3476805 TAAATGGGTAGGTGGATGGATGG + Intronic
1161287571 19:3476885-3476907 TGGATGGGTGGGTGGGTGGATGG + Intronic
1161287582 19:3476932-3476954 TAGATGGGTGGGTGGATGGATGG + Intronic
1161287738 19:3477540-3477562 TAGATGGGTGAGTGGGTGGATGG + Intronic
1161372936 19:3923821-3923843 TGGATGGGTGGGTGGGTGGATGG + Intronic
1161422822 19:4185045-4185067 TGGATGGGTGGGTGGGTGGATGG + Intronic
1161449058 19:4334526-4334548 TGGATGGGTGGGTGGGTGGACGG - Intronic
1161565474 19:4999765-4999787 TAGATGGGTGGGTGGGTGGATGG - Intronic
1161565593 19:5000205-5000227 TGGATGGGTGGGTGGGTGGATGG - Intronic
1161565600 19:5000221-5000243 TGGATGGATAGGTGGGTGGATGG - Intronic
1161632882 19:5367792-5367814 TAGATGGGTAGGTGGGTGAATGG + Intergenic
1161657563 19:5525404-5525426 TGGATGGGTAGGTGGGCGGATGG - Intergenic
1161657572 19:5525439-5525461 TAGATGGTTAGGTGGGTGGGTGG - Intergenic
1161657592 19:5525523-5525545 TGGATGGGTAGGTGGGTGGATGG - Intergenic
1161657601 19:5525558-5525580 TAGATGGTTAGGTGGGTGGGTGG - Intergenic
1161679647 19:5673511-5673533 TGGGTGGGTAGGTGGGTGGATGG - Intergenic
1161679672 19:5673603-5673625 TAGGTGGGTAGGTGGATGGACGG - Intergenic
1161812833 19:6480522-6480544 TAGGTGGGTGGGTGGGTGGATGG - Intronic
1161812842 19:6480546-6480568 TAGATAGGTGGGTGGGTGGATGG - Intronic
1161974060 19:7599282-7599304 GAGTGGGGTGGGTGGGTGGATGG - Intronic
1161974203 19:7599791-7599813 TGGATGGATGGGCGGGTGGATGG - Intronic
1161974275 19:7599991-7600013 TGGATGAGTGGGCGGGTGGATGG - Intronic
1161974281 19:7600011-7600033 TGGATGAGTGGGCGGGTGGATGG - Intronic
1161974287 19:7600031-7600053 TGGATGAGTGGGCGGGTGGATGG - Intronic
1161974293 19:7600051-7600073 TGGATGGATGGGCGGGTGGATGG - Intronic
1161974337 19:7600163-7600185 TAGATGGGTGGGTGGGTGGATGG - Intronic
1161974349 19:7600199-7600221 TAGATGGGTGGGTGGGTGGATGG - Intronic
1161974410 19:7600375-7600397 TGGATGAGTGGGCGGGTGGACGG - Intronic
1161974420 19:7600415-7600437 TGGATGGATGGGCGGGTGGATGG - Intronic
1161974456 19:7600507-7600529 TAGACGAGTGGGTGGGTGGATGG - Intronic
1161974538 19:7600758-7600780 TGGATGGGTGGGTGGGTGGAAGG - Intronic
1161974549 19:7600790-7600812 TAGATGGGTGGGTGGGTGGATGG - Intronic
1162182240 19:8878062-8878084 TAAATGGGTAGGTGGATGGATGG - Intronic
1162203306 19:9036950-9036972 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1162319636 19:9963561-9963583 TGGGGGGGGGGGCGGGTGGAGGG + Intronic
1162388803 19:10377385-10377407 TAGGTGGGTGGGTGGGTGGATGG + Intronic
1162388848 19:10377541-10377563 TGGATGGGTGGGTGGGTGGATGG + Intronic
1162388856 19:10377561-10377583 TGGATGGGTGGGTGGGTGGATGG + Intronic
1162388923 19:10377783-10377805 TAGGTGGATAGGTGGGTGGATGG + Intronic
1162389001 19:10378019-10378041 TGGATGGGTGGGTGGGTGGATGG + Intronic
1162872249 19:13595282-13595304 TGGATGGGTGGACGGGTGGATGG + Intronic
1162872319 19:13595534-13595556 TAGATGGATAGATGGGTGGATGG + Intronic
1163094946 19:15050471-15050493 TAGGTGGGTGGGTGGGTGGATGG + Intronic
1163462180 19:17445638-17445660 TGGATGGGTAAGTGGGTGGATGG - Intronic
1163493959 19:17633849-17633871 TAGATGGGTAGGTGGATGGATGG - Intronic
1163493999 19:17634093-17634115 TAGACGGGTAGGTGGCTGGATGG - Intronic
1163495084 19:17641688-17641710 TAGATGGGTGGGTGTGTGGATGG - Intronic
1163533986 19:17866574-17866596 TTGATGGGCAGGTGGGTGGATGG - Intergenic
1163533992 19:17866590-17866612 TAGATGGGTGGGTGGGTTGATGG - Intergenic
1163551766 19:17969492-17969514 TGGAGGGGTGGAGGGGTGGAGGG - Intronic
1163571283 19:18083807-18083829 TGGATGGGTAGATGGGTGGATGG - Intronic
1163609839 19:18295138-18295160 TAGATGGACAGGTGGGTGGATGG - Intergenic
1163655888 19:18544486-18544508 TAAATGGGTAGGTGGATGGATGG + Intergenic
1163675549 19:18653784-18653806 TGGAAGGGTGGGTGGGTGGATGG - Intronic
1163675624 19:18654027-18654049 TAGGTGGGTAGGTGGGTGGATGG - Intronic
1163675698 19:18654285-18654307 GATAGTGGTAGGCAGGTGGATGG - Intronic
1163675808 19:18654729-18654751 TGGATGGGTAAGTGGGTGGAGGG - Intronic
1163732022 19:18954803-18954825 TGGATGGATGGGCGGGTGGATGG - Intergenic
1163772031 19:19197074-19197096 GAGAGGAGTAGGAGGGTGGGAGG + Intronic
1164441679 19:28284416-28284438 AAGAAGGGAAGGAGGGTGGAAGG + Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164441774 19:28284758-28284780 TAGAGGGGAAGGAGGGTGGGAGG + Intergenic
1164441791 19:28284806-28284828 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441798 19:28284822-28284844 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441805 19:28284838-28284860 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441830 19:28284900-28284922 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441866 19:28285021-28285043 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441877 19:28285053-28285075 CAGAGAGGAAGGAGGGTGGAGGG + Intergenic
1164441921 19:28285207-28285229 TAGAGGGGAAGAAGGGTGCAGGG + Intergenic
1164441932 19:28285238-28285260 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441950 19:28285295-28285317 TGGAGGGGAAGAAGGGTGGAGGG + Intergenic
1164441961 19:28285326-28285348 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164597818 19:29541695-29541717 TTGATGGGTAGTTGGGTGGATGG + Intronic
1164597906 19:29542138-29542160 TAGATGGGTAGATGGGTGGATGG + Intronic
1164597915 19:29542197-29542219 TAGATGGGTAGATGGGTGAATGG + Intronic
1164597953 19:29542435-29542457 TAGATGGGTAGATGGGTTGATGG + Intronic
1164634927 19:29785136-29785158 TAGATGGATTGGTGGGTGGATGG + Intergenic
1164670181 19:30068008-30068030 TAGATGGATGGGTGGGTGGATGG - Intergenic
1164670191 19:30068044-30068066 TGGAGGGATAGATGGGTGGATGG - Intergenic
1164670264 19:30068372-30068394 TAGATGGATGGGTGGGTGGATGG - Intergenic
1164670276 19:30068416-30068438 TGGAGGGATAGATGGGTGGATGG - Intergenic
1164701408 19:30287471-30287493 TAGATGGATAGATGGGTGGATGG + Intronic
1164745471 19:30609758-30609780 TGGATGGGTAGATGGGTGGATGG - Intronic
1164811786 19:31163220-31163242 TAGATGGGTGGGAGGGTAGATGG + Intergenic
1164816350 19:31206298-31206320 TAGATGGGTGGGTGGATGGATGG + Intergenic
1164859044 19:31547936-31547958 TGGATGGGTAGACGGATGGATGG - Intergenic
1164920432 19:32085030-32085052 TGGATGCGTAGGTGGGTGGATGG + Intergenic
1164920447 19:32085082-32085104 TAGGTGGGTAGGTGGGTGGGTGG + Intergenic
1165168289 19:33872434-33872456 TGGATGGGTAGGTGAGTGGATGG - Intergenic
1165168293 19:33872450-33872472 TGGATGGGTAGGTGGATGGATGG - Intergenic
1165168320 19:33872542-33872564 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1165759029 19:38309888-38309910 TAGATGGATAGGTGGATGGATGG - Intronic
1165759056 19:38309996-38310018 TAGATGGGTGGGTGGATGGATGG - Intronic
1165759073 19:38310080-38310102 TTGATGGGTGGGAGGGTGGATGG - Intronic
1165759134 19:38310315-38310337 TGGATGGGTGGGTGGGTGGATGG - Intronic
1166201504 19:41240361-41240383 TGGATGGGTAGATGGGTGGATGG + Intronic
1166840706 19:45695404-45695426 GAGAGAGGTGGGAGGGTGGACGG - Intronic
1167056305 19:47113139-47113161 TAGAGGCTGAGGCGGGAGGAAGG + Intronic
1167144043 19:47671680-47671702 TAGACGGGTAGAAGGATGGAGGG + Intronic
1167144053 19:47671712-47671734 TAGATGGGTAGAAGGATGGAGGG + Intronic
1167144123 19:47671966-47671988 TGGAGGGGTGGGTGGGTAGATGG + Intronic
1167144300 19:47672672-47672694 TAGATGGATGGGAGGGTGGATGG + Intronic
1167338867 19:48903395-48903417 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338887 19:48903459-48903481 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338893 19:48903475-48903497 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338922 19:48903571-48903593 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338942 19:48903635-48903657 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338972 19:48903731-48903753 TGGATGGATGGGCGGGTGGATGG + Intronic
1167338990 19:48903799-48903821 TGGATGGATAGGTGGGTGGATGG + Intronic
1167339025 19:48903919-48903941 TGGATGGGTGGGTGGGTGGATGG + Intronic
1167767683 19:51495154-51495176 TGGACGGGTGGGTGGGTGGATGG + Intronic
1167767712 19:51495246-51495268 TGGACGGGTGGGTGGGTGGATGG + Intronic
1168296956 19:55382015-55382037 CAGATGGGTGGGTGGGTGGATGG - Intronic
1168296991 19:55382159-55382181 TAGATGGGTGGGTGGGTGGATGG - Intronic
1168326697 19:55542408-55542430 TGGATGGGTGGGTGGGTGGATGG - Intronic
1168326774 19:55542708-55542730 TGGATGGGTAGGTGGGTGGGTGG - Intronic
1168326853 19:55542992-55543014 TGGACGGGTGGGTGGGTGGATGG - Intronic
1168326903 19:55543177-55543199 TGGATGGGTGGGTGGGTGGATGG - Intronic
1168326957 19:55543352-55543374 TAGATGGATGGGTGGGTGGATGG - Intronic
1168711379 19:58502060-58502082 CAGATGGGTGGGCAGGTGGATGG + Intronic
925216632 2:2101736-2101758 TAGATGGATAGGTGGATGGATGG - Intronic
925347863 2:3183249-3183271 TAGATGGGTGAGTGGGTGGATGG - Intergenic
925697071 2:6591684-6591706 TAGATGGGTAGATGGATGGATGG - Intergenic
925745284 2:7038775-7038797 TAGATGGATAGATGGGTGGATGG + Intronic
925745287 2:7038783-7038805 TAGATGGGTGGATGGGTGGATGG + Intronic
925745339 2:7039028-7039050 TGGATGGGTAGGTGGATGGATGG + Intronic
925745349 2:7039097-7039119 TAGATGGGTAGATGGATGGATGG + Intronic
925745356 2:7039125-7039147 TGGATGGGTAGGTGGATGGATGG + Intronic
925745366 2:7039194-7039216 TAGATGGGTAGATGGATGGATGG + Intronic
925745373 2:7039222-7039244 TGGATGGGTAGGTGGATGGATGG + Intronic
925745384 2:7039287-7039309 TAGATGGGTAGATGGATGGATGG + Intronic
925745391 2:7039315-7039337 TGGATGGGTAGGTGGATGGATGG + Intronic
925745401 2:7039384-7039406 TAGATGGGTAGATGGATGGATGG + Intronic
925745408 2:7039412-7039434 TGGATGGGTAGGTGGATGGATGG + Intronic
925745415 2:7039481-7039503 TAGATGGGTAGATGGATGGATGG + Intronic
925978338 2:9156582-9156604 TTGATGGGTAGATGGGTGGATGG + Intergenic
926056462 2:9776882-9776904 TGGATGGGTGGGTGGGTGGATGG + Intergenic
926056475 2:9776918-9776940 TGGATGGGTGGGTGGGTGGATGG + Intergenic
926151779 2:10429469-10429491 TGGATGGGTGGGTGGGTGGATGG + Intergenic
926151890 2:10429817-10429839 TGGATGGGTGGGCGGGTGGGTGG + Intergenic
926223286 2:10950113-10950135 TAGATGGGTGAGTGGGTGGATGG + Intergenic
927197738 2:20559693-20559715 TGGACGGGTGGGTGGGTGGATGG + Intergenic
927275373 2:21258054-21258076 TACAGGGGGAGTGGGGTGGAAGG - Intergenic
927848845 2:26486247-26486269 TGGATGGGTGGGTGGGTGGATGG + Intronic
927848892 2:26486435-26486457 TAGATGGGTGGGTGAGTGGATGG + Intronic
927946533 2:27138125-27138147 GAGAGGGGGATGCTGGTGGAGGG + Exonic
928172917 2:29014817-29014839 TGAAGGGGTAGGAGGGAGGAAGG + Intronic
928919500 2:36511878-36511900 TAGGTGGGTGGGTGGGTGGATGG + Intronic
929777550 2:44938479-44938501 TAGAGGAGGTGGCGCGTGGAGGG - Intergenic
930003672 2:46879506-46879528 TAGGTGGGTGGGTGGGTGGATGG + Intergenic
930003683 2:46879550-46879572 TAGATGGGTGGGTGGATGGATGG + Intergenic
930025285 2:47025772-47025794 TAGAGGTGGAGGAGGATGGAGGG - Intronic
930675654 2:54197727-54197749 TAGAAGGCTAGTGGGGTGGAAGG + Intronic
931051388 2:58418794-58418816 TAGATGGGTGGGTGGATGGATGG + Intergenic
931834061 2:66080756-66080778 TAGATGGGTGGGTGGATGGATGG + Intergenic
932005384 2:67922084-67922106 TTGAGGGGTAGGCAGGGGGTTGG + Intergenic
933296816 2:80500395-80500417 TAGATGGGTAGGCGGATGGGTGG - Intronic
933694520 2:85207602-85207624 TGAAAGGGTAGGTGGGTGGATGG + Intronic
933810958 2:86032445-86032467 TGGATGGGTTGGTGGGTGGATGG - Intronic
934613857 2:95759400-95759422 TAGATGGATAGATGGGTGGATGG + Intergenic
934797649 2:97114212-97114234 TTGGGGGGTAGGGGCGTGGACGG + Intronic
934835765 2:97589227-97589249 TTGGGGGGTAGGGGCGTGGATGG - Intronic
935196598 2:100820066-100820088 TGGAGAGGGAGGAGGGTGGAGGG + Intergenic
935448337 2:103180315-103180337 CAGAGGGGAAGCCGGGAGGAGGG + Intergenic
936501141 2:113067240-113067262 CAGATGGGTGGCCGGGTGGATGG + Intergenic
937229059 2:120386745-120386767 TAGATGGGTAGATTGGTGGATGG - Intergenic
937234069 2:120419841-120419863 TAGGTGGGTAGAGGGGTGGATGG - Intergenic
937303499 2:120857393-120857415 CAGATGGGTAGGTGGGTGGGTGG - Intronic
937303530 2:120857481-120857503 CAGATGGGTAGGTGGGTGGCTGG - Intronic
937865508 2:126748500-126748522 AAGAGGGGAAGGCGGGTGCAGGG - Intergenic
937977047 2:127588722-127588744 TAGATGGGTGAGTGGGTGGATGG + Intronic
937977115 2:127588954-127588976 TAGATGGGTGAGTGGGTGGATGG + Intronic
937977176 2:127589168-127589190 TGGACGGGTGGGTGGGTGGATGG + Intronic
937977211 2:127589280-127589302 TGGATGGGTGGGTGGGTGGATGG + Intronic
937977319 2:127589667-127589689 TGGATGGGTGGGTGGGTGGATGG + Intronic
937977382 2:127589861-127589883 TGGATGGGTGGGTGGGTGGATGG + Intronic
938108093 2:128546905-128546927 TAGAGGGGTGGATGGATGGATGG - Intergenic
938373671 2:130790180-130790202 TAGATGGGTAGGTGGGTAAATGG + Intergenic
938665181 2:133527481-133527503 TTGGGGGGTGGGTGGGTGGAGGG - Intronic
938814898 2:134892073-134892095 TGGAAGGGTGGGAGGGTGGATGG + Intronic
938842107 2:135173833-135173855 GATAGGGGTGGGTGGGTGGATGG + Intronic
938924229 2:136024571-136024593 TAGAGGCTGAGGCGGGAGGATGG - Intergenic
939848913 2:147280566-147280588 TGGATGGATGGGCGGGTGGATGG + Intergenic
941015337 2:160349821-160349843 AAGCGGGGTGGGGGGGTGGAGGG + Intronic
941180748 2:162256198-162256220 TAGAGGGGTGGGGGAGTGGGAGG + Intergenic
941574392 2:167212891-167212913 CAGAGGGGTGGGGGGGTGGGGGG - Intronic
941844715 2:170121404-170121426 TGGATGGGTGGGCGGGTGGATGG - Intergenic
943082913 2:183278049-183278071 TGGAGGGATAGATGGGTGGATGG - Intergenic
944765744 2:202862595-202862617 GGGAGGGCGAGGCGGGTGGATGG + Intronic
945267259 2:207902812-207902834 TGGATGGGTGGGTGGGTGGATGG - Intronic
945267266 2:207902828-207902850 TGGATGGGTGGGTGGGTGGATGG - Intronic
946169177 2:217884268-217884290 TAGATGGATGGGTGGGTGGATGG + Intronic
947195969 2:227567975-227567997 TAGAGGGGTAGTAGGATGGGTGG + Intergenic
947800496 2:232926613-232926635 TAGAGGAGGAGGCGTGTGAAGGG - Intronic
947836030 2:233176370-233176392 TAGGTGGGTGGGTGGGTGGATGG + Intronic
947836089 2:233176652-233176674 TGGATGGGTGGGTGGGTGGATGG + Intronic
947836117 2:233176793-233176815 TAGGTGGGTAGGTGGATGGATGG + Intronic
948178358 2:235961330-235961352 TAGACGGGGAGCCGTGTGGAGGG - Intronic
948375430 2:237517630-237517652 TGGATGGATAGGCAGGTGGAGGG + Intronic
948658254 2:239490310-239490332 TTGATGGGTGGGTGGGTGGATGG - Intergenic
948700229 2:239755012-239755034 TAGATGGGTGGGTGGGTGGATGG + Intergenic
948765580 2:240217093-240217115 GTGAGGGGTGGGGGGGTGGAGGG + Intergenic
948815603 2:240508839-240508861 TAGGTGGGTGGGTGGGTGGATGG + Intronic
948815670 2:240509190-240509212 TAGATGGGTGGGTGAGTGGATGG + Intronic
948899849 2:240950747-240950769 TGGATGGGTAGCTGGGTGGAAGG - Intronic
1168852225 20:984859-984881 CAGATGGGTAGGTGGGTGGGTGG - Intronic
1168852253 20:984947-984969 TAGATGGGTGGGTGGGTGGATGG - Intronic
1168852261 20:984971-984993 TAGATGGGTGGGTGAGTGGATGG - Intronic
1168852273 20:985015-985037 TAGATGGGTTGGTGGATGGATGG - Intronic
1168852290 20:985083-985105 TAGATGGGTGGGTGAGTGGATGG - Intronic
1168852298 20:985115-985137 TAGATGAGTGGGTGGGTGGATGG - Intronic
1168852309 20:985159-985181 CAGATGGGTAGGTGGGTGGGTGG - Intronic
1168852334 20:985237-985259 TAGATGGGTGGGTGAGTGGATGG - Intronic
1168852341 20:985265-985287 TAGATGAGTGGGTGGGTGGATGG - Intronic
1168947062 20:1769702-1769724 TAGATGGATGGGTGGGTGGATGG + Intergenic
1168952928 20:1814908-1814930 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1168952939 20:1814940-1814962 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1168952969 20:1815044-1815066 TGGATGGGTTGGTGGGTGGATGG + Intergenic
1168973168 20:1944890-1944912 TAGAGGGATGGGAGGATGGACGG + Intergenic
1169189184 20:3646521-3646543 TGGAGGGGAAGGCGGAGGGAGGG + Intronic
1169250651 20:4058292-4058314 TAGAGAGGTGGGCGGGGGGGGGG + Intergenic
1169437464 20:5605726-5605748 TGGAGGGGGAGGCAGGTGGGGGG - Intronic
1169817602 20:9674339-9674361 TTGAGGGGTAGGCAGGGAGAGGG - Intronic
1169993028 20:11524697-11524719 TAGAGGGGGAGGCTGGGAGAAGG - Intergenic
1170769372 20:19318663-19318685 TAGAAGGGTAGGTGTGGGGAGGG + Intronic
1170885540 20:20337339-20337361 TAGATGGGTGGGTGGGTGGATGG + Intronic
1170885556 20:20337399-20337421 TAGATGGGTGGGTGGATGGATGG + Intronic
1170885565 20:20337435-20337457 TAGATGGGTGGGTGGATGGATGG + Intronic
1170885573 20:20337463-20337485 TAGATGGGTGGGTGGATGGATGG + Intronic
1170885590 20:20337531-20337553 TAGATGGGTGGGTGGATGGATGG + Intronic
1170885610 20:20337605-20337627 TAGATGGGTGGGTGGGTGGATGG + Intronic
1170885621 20:20337641-20337663 TAGATGGGTGGGTGGGTGGATGG + Intronic
1171289620 20:23974723-23974745 TAGATGGGTAGATGGGTGGATGG - Intergenic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172113985 20:32563061-32563083 TGGAGGGGAAGGAGGGTGAAGGG + Intronic
1172113992 20:32563077-32563099 TGAAGGGGAAGGAGGGTGGAGGG + Intronic
1172196205 20:33093387-33093409 TGGATGGGTGGGTGGGTGGATGG - Intronic
1172271833 20:33659464-33659486 GAGAGGGGCAAGCGGCTGGATGG - Intronic
1172615467 20:36280604-36280626 TAGATGGGTAGATGGATGGATGG - Intergenic
1172779923 20:37430451-37430473 TGGATGGATGGGCGGGTGGATGG - Intergenic
1172899070 20:38320912-38320934 TAGGTGGGTAGACAGGTGGATGG + Intronic
1172899149 20:38321194-38321216 TAGATGGGTAGGCGGATGAGTGG + Intronic
1172976118 20:38907296-38907318 TGGATGGGTGGGTGGGTGGATGG + Intronic
1173021324 20:39269955-39269977 TAGCTGGGTAGGTGGGTGGCTGG - Intergenic
1173369709 20:42424447-42424469 GAGAGTGGGAGGCAGGTGGAAGG - Intronic
1173465090 20:43274292-43274314 TAAAGGGGTGGGTGTGTGGATGG + Intergenic
1173531150 20:43770593-43770615 CAGATGGGTGGGTGGGTGGATGG - Intergenic
1173871494 20:46344874-46344896 TAGATGGATAGGTGGATGGATGG - Intergenic
1173912611 20:46681440-46681462 AAGAGGGGAAGGAGGGAGGAGGG + Intronic
1173974754 20:47178810-47178832 TGGATGGGTGGGTGGGTGGATGG + Intronic
1174174103 20:48634205-48634227 TAAATGGGTGGGCAGGTGGAAGG + Intronic
1174175307 20:48640852-48640874 TGGATGGGTAGGTGGGTAGATGG + Intronic
1174175718 20:48643546-48643568 TGGATGGGCAGGTGGGTGGATGG - Intronic
1174275510 20:49400986-49401008 TAGGTGGGTAGGTGGATGGATGG - Intronic
1174295430 20:49542132-49542154 CAGAGAGGTAGGTGGGAGGAGGG + Intronic
1174302393 20:49592140-49592162 TAGATGGATAGATGGGTGGATGG - Intergenic
1174305142 20:49609730-49609752 TGGATGGGTAGGTGGATGGATGG - Intergenic
1174390299 20:50214753-50214775 GAGATGGGTAGACGGATGGATGG + Intergenic
1174410201 20:50330337-50330359 TAGATGGGTGGGTGGATGGATGG + Intergenic
1174459301 20:50671725-50671747 TAGATGGGTAGATGGATGGAAGG + Intronic
1174459373 20:50672015-50672037 TGGATGGGTAGGTGGGTGGGTGG + Intronic
1174564547 20:51455829-51455851 TTGATGGGTGGGTGGGTGGATGG + Intronic
1174564621 20:51456053-51456075 TGGATGGGTGGGTGGGTGGATGG + Intronic
1174619213 20:51861463-51861485 TGGATGGATAGGTGGGTGGATGG - Intergenic
1175008944 20:55715199-55715221 TGGAGGGGTAGGTGTGTGGGGGG + Intergenic
1175137948 20:56839225-56839247 TAGATGGGTAGGTGGGCAGATGG + Intergenic
1175189758 20:57203374-57203396 TAGATGGGTAGGTGAGTGAATGG + Intronic
1175189778 20:57203462-57203484 TAGATGAGTGGGTGGGTGGATGG + Intronic
1175277290 20:57780876-57780898 TAGATGGATGGGTGGGTGGATGG - Intergenic
1175325914 20:58128508-58128530 TAGGTGGGGAGGTGGGTGGATGG + Intergenic
1175407476 20:58744380-58744402 TAGATGGGTAGATGTGTGGATGG + Intergenic
1175526591 20:59638699-59638721 TGGAGGGATGGGTGGGTGGATGG + Intronic
1175770466 20:61620171-61620193 TGGATGGGTGGGTGGGTGGATGG + Intronic
1175780271 20:61677724-61677746 TAGGCAGGTAGGCAGGTGGATGG + Intronic
1175798961 20:61790140-61790162 TAGATGGGTGGGTGTGTGGATGG - Intronic
1175817850 20:61892967-61892989 TAGAGGGATAGATGGGTGGATGG + Intronic
1175817924 20:61893243-61893265 TGGATGGGTGGGTGGGTGGATGG + Intronic
1175817985 20:61893488-61893510 TGGATGGGTAGGTGGGTGGATGG + Intronic
1175901125 20:62360311-62360333 TAGGGGGGTGGGTGGGTGGATGG + Intronic
1175901199 20:62360508-62360530 TAGATGGGTGGGTGGGTGGGTGG + Intronic
1175901215 20:62360555-62360577 TGGAGGGATAGATGGGTGGATGG + Intronic
1175901229 20:62360595-62360617 TAGGTGGGTGGGTGGGTGGATGG + Intronic
1175901244 20:62360631-62360653 TAGATGGGTGGGTGGGTGGGTGG + Intronic
1175901255 20:62360659-62360681 TAGATGGGTGGGTGGGTGGAGGG + Intronic
1175904410 20:62372421-62372443 TAGAGGGTGGGGCGGGTGGGGGG + Intergenic
1175934681 20:62509428-62509450 TGGAGGGGTGGAGGGGTGGAGGG - Intergenic
1175934738 20:62509566-62509588 TGGAGGGGTGGAGGGGTGGAGGG - Intergenic
1175934742 20:62509574-62509596 TGGAGGGGTGGAGGGGTGGAGGG - Intergenic
1175934775 20:62509659-62509681 TGGAGGGGTGGAGGGGTGGAGGG - Intergenic
1175935157 20:62510713-62510735 TGGAGGGGTGGAGGGGTGGAGGG - Intergenic
1176129729 20:63491643-63491665 TGGATGGGGAGGTGGGTGGATGG + Intronic
1176129841 20:63492079-63492101 TAGAGAGGTGGATGGGTGGATGG + Intronic
1176129885 20:63492235-63492257 TGGATAGGTAGGTGGGTGGATGG + Intronic
1177213482 21:18099076-18099098 TGGAAGGGTAGTGGGGTGGAAGG + Intronic
1177667609 21:24181408-24181430 TAGGGGGGTGGGGGGGTGGTGGG - Intergenic
1179017289 21:37604964-37604986 TGGATGGGTAGATGGGTGGATGG - Intergenic
1179017294 21:37604980-37605002 TGGATGGGTAGATGGGTGGATGG - Intergenic
1179017329 21:37605120-37605142 TAGATGGGTAGATGGGTGGATGG - Intergenic
1179017379 21:37605332-37605354 TAGATGGGTATATGGGTGGATGG - Intergenic
1179017387 21:37605364-37605386 TGGATGGGTAGAAGGGTGGATGG - Intergenic
1179017392 21:37605380-37605402 TGGAAGGGTAGATGGGTGGATGG - Intergenic
1179017402 21:37605412-37605434 TAGAAGGGTAGATGAGTGGATGG - Intergenic
1179017407 21:37605436-37605458 TAGAAGGGTAGATGAGTGGATGG - Intergenic
1179343424 21:40533713-40533735 TAGATGGGTGGGTGGGTGGGTGG - Intronic
1179465258 21:41567519-41567541 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1179483594 21:41694226-41694248 TGGATGGGTAGGTGGATGGATGG - Intergenic
1179551052 21:42144254-42144276 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1179563796 21:42234160-42234182 CAGAAGGGAAGGAGGGTGGAGGG + Intronic
1179644068 21:42764968-42764990 TTGTGGGGTGGGTGGGTGGATGG + Intronic
1179874852 21:44262388-44262410 TGGAGGGGTGGAGGGGTGGAGGG + Intergenic
1179978624 21:44885007-44885029 AAGAGGTGTAGACGGCTGGAGGG + Intergenic
1179978638 21:44885070-44885092 AAGAGGTGTAGACGGCTGGAGGG + Intergenic
1179978652 21:44885133-44885155 AAGAGGTGTAGACGGCTGGAGGG + Intergenic
1179978666 21:44885196-44885218 AAGAGGTGTAGACGGCTGGAGGG + Intergenic
1179978737 21:44885511-44885533 AAGAGGTGTAGACGGCTGGAGGG + Intergenic
1180052809 21:45340426-45340448 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1180085986 21:45508120-45508142 TGGACGGGTGGGTGGGTGGATGG + Intronic
1180182362 21:46123686-46123708 TAGGTGGGTAGGTGGGTAGATGG + Intronic
1180182434 21:46123982-46124004 GGGATGGGTAGGTGGGTGGATGG + Intronic
1180624108 22:17182468-17182490 AACAGGGGTAGGAGAGTGGAGGG + Intronic
1181338295 22:22157801-22157823 TAGAGAGAAAGGTGGGTGGAGGG + Intergenic
1181376130 22:22459707-22459729 TTGAGGAGTAGGTGGGTGGGAGG - Intergenic
1181523182 22:23460822-23460844 TAGCAGGGTAGGCGGGAGGAGGG + Intergenic
1181597581 22:23926701-23926723 CAGAGGGGTGGGTGAGTGGATGG - Intergenic
1181750599 22:24986643-24986665 TGGATGGGTGGGTGGGTGGATGG - Intronic
1181750622 22:24986703-24986725 TGGATGGGTGGGTGGGTGGATGG - Intronic
1181783237 22:25207771-25207793 TAGATGGGTGGGTGGGTGGATGG - Intergenic
1181822634 22:25487621-25487643 TGGATGGAAAGGCGGGTGGAAGG + Intergenic
1182023746 22:27101453-27101475 AAGATGGGTTGGTGGGTGGATGG - Intergenic
1182047351 22:27285758-27285780 TAGGTGGGTGGGTGGGTGGATGG + Intergenic
1182052633 22:27324893-27324915 TGGACGGGTAGGTGGATGGATGG + Intergenic
1182086617 22:27565417-27565439 TAGATGGGTGAGTGGGTGGATGG + Intergenic
1182099678 22:27649090-27649112 TAGAAGGGTGGGTGGGTGGATGG + Intergenic
1182279584 22:29209971-29209993 TAGAGGTGCAGGAGGGTGGCAGG + Intronic
1182429772 22:30292658-30292680 TCTAGGGGCAGGCGGATGGATGG + Exonic
1182458381 22:30467291-30467313 TACGGGGGTGGGTGGGTGGATGG - Intronic
1182471941 22:30554167-30554189 TAGGGGGCTGGGCGGGTAGAGGG - Intergenic
1182686457 22:32124067-32124089 CAGAGCGGTAGGAGGGTGGCTGG + Intergenic
1183082206 22:35463668-35463690 TAGATGGGTGGATGGGTGGATGG - Intergenic
1183097983 22:35565768-35565790 TGGTGGGGTAGGCGGGTGAGAGG - Intergenic
1183261868 22:36800365-36800387 TGGATGGGTAGGTGGATGGATGG - Intergenic
1183262330 22:36803658-36803680 TGGATGGGTGGGTGGGTGGATGG + Intronic
1183304164 22:37073149-37073171 TAGATGGGTGGGTGGATGGATGG + Intronic
1183724974 22:39583436-39583458 TGGATGGGTGGGCGGGTGGATGG - Intronic
1183731298 22:39620047-39620069 TGGATGGGTGGGTGGGTGGATGG - Intronic
1183731386 22:39620423-39620445 TAGGTGGGTGGGCAGGTGGATGG - Intronic
1184045376 22:41969679-41969701 TAGGTGTGTAGGGGGGTGGAAGG + Intergenic
1184123679 22:42471601-42471623 TAGGTGGGTAGGTGGGTGAAAGG - Intergenic
1184206792 22:43009664-43009686 CAGAGGGGGAGGAGCGTGGATGG - Intronic
1184264977 22:43342133-43342155 TGGAGGGGGAGGCAGGGGGAGGG - Intronic
1184444532 22:44539621-44539643 TGGATGGATAGGTGGGTGGATGG + Intergenic
1184444593 22:44539860-44539882 TAGATGGATAGGTGAGTGGATGG + Intergenic
1184444623 22:44539983-44540005 TGGACGGGTAGGTGGATGGATGG + Intergenic
1184444628 22:44539999-44540021 TGGATGGATAGGTGGGTGGATGG + Intergenic
1184444665 22:44540123-44540145 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1184731164 22:46371909-46371931 CAGATGGGTGGGTGGGTGGATGG - Intronic
1184731200 22:46372080-46372102 TGGATGGGTAGGTGGATGGAGGG - Intronic
1184779958 22:46643047-46643069 TGGATGGGTAGGTGGGTGGATGG - Intronic
1184780739 22:46648103-46648125 TAGATGGGTGGACGGGTGGGTGG + Intronic
1184787899 22:46680710-46680732 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1184787947 22:46680862-46680884 TAGATGGATAGGTGGGTGGGTGG - Intergenic
1184855136 22:47142522-47142544 TGGATGGGTAGGTGGATGGATGG - Intronic
1184855142 22:47142542-47142564 TAGATGGGTGGGTGGGTGGATGG - Intronic
1184977551 22:48073610-48073632 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1185063856 22:48621028-48621050 TGGATGGGTGGGAGGGTGGATGG - Intronic
1185076737 22:48687238-48687260 TAGATGGATAGGTGGATGGATGG + Intronic
1185103640 22:48855088-48855110 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1185156269 22:49195312-49195334 TAGAGGAGTGAGCGGGAGGATGG - Intergenic
1185212869 22:49581701-49581723 TGGATGGGTAGATGGGTGGATGG - Intronic
1185276050 22:49950556-49950578 TAGGGGGGTGGGGGGGTGGGGGG + Intergenic
949934863 3:9108740-9108762 TGGATGGGTAGGTGGGTGGGTGG + Intronic
950102841 3:10368699-10368721 TAGATGGGTGGATGGGTGGATGG - Intronic
950116520 3:10454011-10454033 TAGATGGGTCGGTGGGTGGTGGG - Intronic
950122022 3:10488285-10488307 TAGATAGGTGGGTGGGTGGATGG - Intronic
950474367 3:13206161-13206183 TGGAGGGGTGGATGGGTGGATGG - Intergenic
950474375 3:13206181-13206203 TGGAGGGGTGGATGGGTGGATGG - Intergenic
950532181 3:13558669-13558691 TGGGTGGGTGGGCGGGTGGATGG - Intronic
950541243 3:13614610-13614632 TGGGTGGGTAGGTGGGTGGATGG - Intronic
950541829 3:13617663-13617685 TAGATGGATGGGTGGGTGGATGG - Intronic
950541863 3:13617764-13617786 TAGATGGATGGGTGGGTGGATGG - Intronic
950541902 3:13617910-13617932 TGGATGGGTGGGTGGGTGGATGG - Intronic
950750852 3:15126975-15126997 TAGATGGGTAGGTGGGTGGATGG - Intergenic
950837735 3:15936626-15936648 TGGGGGGGTAAGTGGGTGGAAGG - Intergenic
953193417 3:40710739-40710761 TAGAGTCTTAGGAGGGTGGATGG - Intergenic
953362915 3:42315273-42315295 TGGAAGGGTGGGAGGGTGGAAGG - Intergenic
954436286 3:50498102-50498124 GAGTGGGGTAGGTGGCTGGAAGG + Intronic
954750243 3:52809494-52809516 TGGATGGGTACGTGGGTGGATGG - Intergenic
954989426 3:54827354-54827376 TGGAAAGGTAGGCGTGTGGATGG + Intronic
955201348 3:56854764-56854786 TAGAGGGGTGGGGGGGTTGGGGG + Intronic
955690903 3:61589766-61589788 TGGATGGGTAGATGGGTGGATGG + Intronic
955783401 3:62510107-62510129 TAGATAGGTGGGTGGGTGGATGG - Intronic
956121855 3:65974360-65974382 TGGATGGGTGGGCGGGTGGGCGG + Intronic
956647143 3:71467397-71467419 TACATGGGTAGGTGGGTGGGTGG + Intronic
956750947 3:72343581-72343603 TAGATGGGTGGGTGGATGGATGG - Intergenic
956882166 3:73521377-73521399 GGGAGGGGTAGGCGGGCAGATGG + Intronic
957070592 3:75564836-75564858 TAGATGGGTGGGTGGGTGGATGG + Intergenic
958715700 3:97777366-97777388 TATATAGGTAGGAGGGTGGAAGG - Intronic
958997206 3:100918336-100918358 TAGATGAGTGGACGGGTGGATGG - Intronic
959930884 3:111980897-111980919 CGGATGGGTGGGCGGGTGGATGG + Intronic
960057237 3:113284369-113284391 TATACGGGCAGGAGGGTGGAAGG - Exonic
961283494 3:125781718-125781740 TAGATGGTAAGGTGGGTGGATGG - Intergenic
961335597 3:126177550-126177572 TAGGGGGGTTGGGGGGTGGATGG + Intronic
961475956 3:127146436-127146458 TAGATGGATGGGTGGGTGGATGG + Intergenic
962202800 3:133414787-133414809 TAGAGGGGTAAGCGGGGGGGGGG - Intronic
962571663 3:136719640-136719662 TAGGTGGGTAGGTGGGTGGGTGG + Intronic
962606231 3:137035054-137035076 TGGAGGGATGGGAGGGTGGAGGG + Intergenic
962840753 3:139230424-139230446 AAGAGGGATTGGAGGGTGGAAGG - Intronic
962945432 3:140164928-140164950 TAGATGGGTGGGTGGATGGATGG + Intronic
962969059 3:140382080-140382102 TAGAGAGATGGGAGGGTGGAGGG - Intronic
964232065 3:154482108-154482130 TAGAGGGGTAGAGGGGTGAAAGG - Intergenic
964514135 3:157488957-157488979 AAGAGGGGGAGGTGGGGGGAAGG - Intronic
965527674 3:169738876-169738898 TGGAGGCTGAGGCGGGTGGATGG - Intergenic
966300746 3:178476869-178476891 TAGAGGAGAAGGAGAGTGGAAGG + Intronic
966930811 3:184674405-184674427 TGGATGGGTGGGTGGGTGGATGG + Intronic
967159539 3:186723414-186723436 GAGCGGGGTAAGCGGGTAGAAGG - Intronic
967332134 3:188301088-188301110 TAGAGAGGCAGGAGGGTGGATGG - Intronic
968598652 4:1498580-1498602 ATGAGGGGTGGGCAGGTGGATGG + Intergenic
968733544 4:2283502-2283524 TAGATGGATGGGTGGGTGGATGG - Intronic
968762077 4:2447815-2447837 TGGATGGGTGGGTGGGTGGATGG + Intronic
968924753 4:3541377-3541399 TAGATGGGTAGGTGGATGGGTGG + Intergenic
968924867 4:3541838-3541860 TAGGTGGGTGGGTGGGTGGATGG + Intergenic
968928084 4:3560528-3560550 TGGATGGGTGGGTGGGTGGATGG - Intergenic
968931023 4:3578893-3578915 TAGATGGGTAGATGGGTGGATGG - Intronic
969014204 4:4092467-4092489 TAGATGGGTGGGTGGGTGGGTGG + Intergenic
969014211 4:4092491-4092513 TAGATGGGTAGGTGGGTGGATGG + Intergenic
969088612 4:4675376-4675398 TAGATGGATAGGTGGGTGGATGG - Intergenic
969091273 4:4695685-4695707 TGGATGGGTGGGTGGGTGGATGG - Intergenic
969219214 4:5748692-5748714 TGGATGGGTGGACGGGTGGATGG - Intronic
969219220 4:5748708-5748730 TGGATGGGTGGGTGGGTGGATGG - Intronic
969448951 4:7262202-7262224 TGGATGGGTGGGTGGGTGGATGG - Intronic
969448962 4:7262246-7262268 TGGATGGATAGGTGGGTGGATGG - Intronic
969448967 4:7262262-7262284 TAGATGGATAGGTGGGTGGATGG - Intronic
969448991 4:7262354-7262376 TAGATGGATAGGTGGGTGGATGG - Intronic
969482998 4:7456769-7456791 GGCAGGGGTAGGGGGGTGGAGGG + Intronic
969514924 4:7641857-7641879 TGGATGGGTGGGTGGGTGGATGG + Intronic
969523088 4:7690144-7690166 TGGATGGGTGGGTGGGTGGATGG + Intronic
969524033 4:7695257-7695279 TAGATGGATGGGTGGGTGGATGG + Intronic
969524120 4:7695525-7695547 TGGATGGGTGGGTGGGTGGATGG + Intronic
969524222 4:7695861-7695883 TGGATGGGTGGGTGGGTGGATGG + Intronic
969565455 4:7974641-7974663 TAGGTGGGTAGGTGGGTGGATGG - Intronic
969624437 4:8295163-8295185 TAGAGGGACAGGTGGGTAGACGG - Intronic
969643679 4:8413628-8413650 TGGAGGGGTGGAGGGGTGGAGGG - Intronic
969739768 4:9015917-9015939 TAGATGGGTAGGTGGGTGGATGG - Intergenic
970062356 4:12049561-12049583 TAGAGGTGGAGGCTGGTGGGAGG + Intergenic
970309736 4:14769535-14769557 TAGATGGATGGGTGGGTGGATGG + Intergenic
970832707 4:20361308-20361330 TAGATGGGTGGACGGGTGGATGG - Intronic
970832710 4:20361316-20361338 TGGATGGGTAGATGGGTGGACGG - Intronic
972426104 4:38934400-38934422 TGGATGGGTGGGTGGGTGGATGG + Intronic
972445983 4:39144383-39144405 GAAAGGGGGAGGAGGGTGGAAGG - Intergenic
973744294 4:53948208-53948230 TAGATGGGTAGATGGATGGATGG + Intronic
975765764 4:77666217-77666239 TTGAGGGGCGGGAGGGTGGAGGG + Intergenic
976167082 4:82267582-82267604 TGGAGGGGTAGGATGGTGAAGGG - Intergenic
977144025 4:93412739-93412761 TAGTGGGGTAGGCAAGGGGAGGG - Intronic
977390099 4:96398000-96398022 TTGAGGGGTTGGGGGGTGAAGGG - Intergenic
979611860 4:122697806-122697828 TAGAGGGCCAGGGTGGTGGATGG - Intergenic
979876571 4:125898882-125898904 AAGAGAGGGAGGCGGGGGGAGGG - Intergenic
980154451 4:129087647-129087669 AAGAGGGTGAGGCAGGTGGAGGG + Intronic
980303941 4:131031829-131031851 TAGAGGTGGAGGCTGGTGGAAGG + Intergenic
981611918 4:146602236-146602258 TGGAAGGGAAGGAGGGTGGAAGG - Intergenic
982102641 4:151983167-151983189 AAGAGGGGTGGGCGGGTAGGTGG + Intergenic
982632107 4:157843640-157843662 TTGAGGGGTGGATGGGTGGATGG + Intergenic
985111508 4:186551528-186551550 TAGGTGGGTAGGTAGGTGGATGG + Intronic
985560558 5:584031-584053 TGGATGGGTGGGCGGGTGGATGG + Intergenic
985560912 5:585254-585276 TAGAAGGGTGGGTGGATGGATGG + Intergenic
985662846 5:1165979-1166001 TAGATGGGTGGGTGGATGGATGG - Intergenic
985662903 5:1166199-1166221 TAGATGGTTAGGTGGATGGATGG - Intergenic
985663022 5:1166697-1166719 TAGATGGATAGGTGGGTAGATGG - Intergenic
985821186 5:2161221-2161243 TAGATGGATTGGAGGGTGGATGG - Intergenic
985821199 5:2161269-2161291 TGGATGGGTGGGTGGGTGGATGG - Intergenic
985837214 5:2280315-2280337 TGGGTGGGTAGGTGGGTGGATGG + Intergenic
985837420 5:2281190-2281212 TAGATGAGTGGGCAGGTGGATGG + Intergenic
985837450 5:2281290-2281312 TGGATGGGTAGGTGGGTGGATGG + Intergenic
985874445 5:2584672-2584694 TGGATGGGTAGATGGGTGGATGG + Intergenic
987077456 5:14397442-14397464 TGGATGGGTAGGTGGGTGTATGG + Intronic
987087449 5:14483750-14483772 TGGAGGGGCAGGCGGGTGGTGGG - Intronic
987242992 5:16020184-16020206 TAGGGAGGTAGGTGGATGGATGG + Intergenic
988612172 5:32737103-32737125 TAGGAGGGGAGGAGGGTGGAAGG - Intronic
988844233 5:35113110-35113132 TAAATGGGTGGGCGGGTTGATGG - Intronic
988844249 5:35113170-35113192 TAGATGGGTGGGTGGATGGAGGG - Intronic
988844281 5:35113289-35113311 TAGATGGGTGGGTGGATGGATGG - Intronic
988844318 5:35113429-35113451 TAGGTGGGTGGGTGGGTGGATGG - Intronic
988844335 5:35113485-35113507 TAGATAGGTGGGTGGGTGGATGG - Intronic
988989028 5:36651347-36651369 TTGTGGGGTAGGCGGATGGCAGG - Intronic
989664049 5:43832024-43832046 AAGTGGGGTAGGTGGGTGGATGG - Intergenic
990608006 5:57429595-57429617 TGGAGGGCTAGGCAGGGGGAGGG + Intergenic
990817352 5:59800607-59800629 TAGGGGGGTAGGGGTGGGGAGGG - Intronic
992000046 5:72427480-72427502 TAGATGGGTAGATGGTTGGATGG - Intergenic
992097368 5:73375568-73375590 TAGATGTGTAGGTGGGTAGATGG - Intergenic
992537962 5:77730711-77730733 TGGATGGGTAGGTGGGTGGATGG - Intronic
992901377 5:81300512-81300534 TATGGGGGTAGGGGGCTGGAAGG + Intergenic
993556498 5:89346169-89346191 TAGATGGGTGGGTGGATGGATGG - Intergenic
996229747 5:121047579-121047601 TAGAAGGATAAGCGGATGGATGG + Intergenic
996391725 5:122969890-122969912 AATAGGGGTAGGTGGGTGGGTGG - Intronic
996876265 5:128243629-128243651 CAGACGGGTAGGTGGGTAGATGG + Intergenic
997578036 5:134997756-134997778 GAGAGGGGTAGGCAGGTGGAGGG - Intronic
998036720 5:138923627-138923649 TAGAGGCTGAGGCGGGAGGATGG - Intronic
998569830 5:143247311-143247333 TAGGTGGGTAGGTGGATGGATGG + Intergenic
998620965 5:143793823-143793845 TAGATGGGTGGGCGGGTGGATGG - Intergenic
999386579 5:151157861-151157883 TAGAGGGGTGGGGTGGAGGAGGG - Exonic
1000279823 5:159773064-159773086 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1000381870 5:160636780-160636802 TAGATGGGTAGGTGGATGGATGG - Intronic
1000381910 5:160636980-160637002 TGGATGGGTGGGTGGGTGGATGG - Intronic
1000381968 5:160637285-160637307 TAGGTGGGTAGGAGGGTGGATGG - Intronic
1001088998 5:168723235-168723257 TAGATGGGTAAGTGGGTGGGTGG - Intronic
1001413307 5:171525926-171525948 TGGATGGGTAGGTGGGTGGGTGG - Intergenic
1001435436 5:171695849-171695871 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1001481061 5:172089479-172089501 TAGATGAGTGGGTGGGTGGATGG + Intronic
1001481141 5:172089938-172089960 TGGAGGGGTGAGTGGGTGGAAGG + Intronic
1001754612 5:174158991-174159013 TGGATGGGTCGGTGGGTGGATGG - Intronic
1001778487 5:174347304-174347326 TAGATGGGTGGGTGAGTGGATGG + Intergenic
1001828800 5:174767900-174767922 TAGGTGGGTAGGTGGGTGGTTGG - Intergenic
1001833697 5:174811626-174811648 TACATGGGTAGGTGAGTGGATGG - Intergenic
1001840396 5:174871344-174871366 TAGGTGGGTAGGTGGGTGGATGG - Intergenic
1001855766 5:175009405-175009427 TAGATGGGTAGATGGGTGGATGG + Intergenic
1002022725 5:176375116-176375138 TGGACGGGTGGACGGGTGGACGG - Exonic
1002022728 5:176375124-176375146 TGGATGGGTGGACGGGTGGACGG - Exonic
1002022734 5:176375140-176375162 TGGATGGGTGGGTGGGTGGATGG - Exonic
1002303226 5:178269343-178269365 TGGATGGGTGGGTGGGTGGATGG - Intronic
1002303253 5:178269423-178269445 TGGATGGGTGGGTGGGTGGATGG - Intronic
1002303344 5:178269725-178269747 TGGATGGGTAGGTGGGTGGATGG - Intronic
1002642074 5:180635183-180635205 TGGATGGGTGGGTGGGTGGATGG + Intronic
1002642087 5:180635223-180635245 TGGATGGGTGGGTGGGTGGATGG + Intronic
1002642100 5:180635263-180635285 TGGATGGGTGGGTGGGTGGATGG + Intronic
1002642303 5:180635950-180635972 TGGATGGGTGGGTGGGTGGATGG + Intronic
1002658980 5:180777595-180777617 TAGATGGATGGGTGGGTGGATGG - Intergenic
1002659003 5:180777667-180777689 TAAATGGGTGGGTGGGTGGATGG - Intergenic
1002660859 5:180790445-180790467 GAGAGGGCTAGACGGGTGGGAGG - Intergenic
1002888808 6:1317062-1317084 GAGGGGGGTGGGCGGGGGGAGGG - Intergenic
1002888864 6:1317166-1317188 GGGAGGGGTAGGCGGGAGGAGGG - Intergenic
1002888926 6:1317285-1317307 GAGAGGAGCAGGCGGGGGGAGGG - Intergenic
1002917970 6:1544244-1544266 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1003151574 6:3556126-3556148 TGGATGAGTAGGTGGGTGGATGG + Intergenic
1003152071 6:3561235-3561257 TAGGTGGGTGGGTGGGTGGATGG - Intergenic
1004554127 6:16679189-16679211 TGGATGGGTGGGTGGGTGGACGG + Intronic
1004554170 6:16679353-16679375 TAGATGGATAGGTGGGTGGGTGG + Intronic
1005061195 6:21778623-21778645 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1005223908 6:23619964-23619986 TAGATAGGTAGGTGGGGGGAGGG + Intergenic
1005715639 6:28544539-28544561 TAGGGGGGTGGGGGAGTGGAGGG + Intergenic
1005740763 6:28788377-28788399 TAGAGTGTTAGACTGGTGGATGG + Intergenic
1006370210 6:33639683-33639705 TGGATGGGTAGATGGGTGGATGG + Intronic
1006370213 6:33639691-33639713 TAGATGGGTGGATGGGTGGATGG + Intronic
1006528029 6:34625171-34625193 AAGAGGGGAAGGGGGGAGGAGGG - Intronic
1007147133 6:39647375-39647397 AAGAGGGGCAGGCAGGTGTATGG + Intronic
1007326610 6:41066229-41066251 TAGAGGTTGAGGCGGGAGGATGG - Exonic
1007785360 6:44276552-44276574 GCGAGGGGCAGGCGGGAGGACGG - Exonic
1008765936 6:54915142-54915164 TAGATGGGTAGATGTGTGGATGG + Intronic
1010315294 6:74441851-74441873 TTGAGGGGTAGGTGGGTGAGGGG - Intergenic
1011410238 6:87059749-87059771 GGGAGGGGGAGGCGGGGGGAGGG + Intergenic
1013309320 6:108879057-108879079 TAGACGGATGGGTGGGTGGATGG - Intronic
1013309347 6:108879172-108879194 TAGGTGGATAGGTGGGTGGATGG - Intronic
1013309370 6:108879256-108879278 TGGATGGGTAGACAGGTGGATGG - Intronic
1013309426 6:108879506-108879528 TAGATGGGTAGATGGGTGGGTGG - Intronic
1014273157 6:119356744-119356766 TGGAGGGATAGGAGGATGGAGGG + Intergenic
1014482215 6:121952912-121952934 TTGAGGGGTAGGCTGGTGCTGGG + Intergenic
1015302746 6:131672888-131672910 TGGATGGATAGGTGGGTGGATGG + Intronic
1017017540 6:150113884-150113906 TAGTGGGGAGGACGGGTGGAAGG - Intergenic
1017821718 6:158053864-158053886 TAGATGGATAGGTGGGTGGATGG - Intronic
1017821806 6:158054253-158054275 TGGATGGGTAGGTGGGTGGATGG - Intronic
1018305943 6:162455281-162455303 CAGAGGAGTAGGTGGATGGATGG - Intronic
1018913092 6:168115372-168115394 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1018913121 6:168115472-168115494 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1019055183 6:169218520-169218542 TGGATGGGTGGGTGGGTGGATGG + Intronic
1019055241 6:169218754-169218776 TGGATGGGTGGGTGGGTGGATGG + Intronic
1019345616 7:528837-528859 TACATGGGTAGATGGGTGGAGGG + Intergenic
1019390529 7:784129-784151 CAGAGGTGCAGGCAGGTGGACGG - Intronic
1019489734 7:1306630-1306652 TAGATGGATGGGTGGGTGGATGG - Intergenic
1019503626 7:1378747-1378769 TAGAGAGATAGGTGGATGGATGG + Intergenic
1019510553 7:1415440-1415462 TGGATAGGTGGGCGGGTGGATGG + Intergenic
1019510702 7:1415981-1416003 TAGATGGGTAGGTGGGTGGGTGG + Intergenic
1019510732 7:1416085-1416107 TGGATGGGTAGGTGGGTGGGTGG + Intergenic
1019546249 7:1578128-1578150 CAGATGGGTAGGTGGATGGATGG - Intergenic
1019546311 7:1578392-1578414 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1019549452 7:1594811-1594833 TGGATGGGTGGGAGGGTGGATGG - Intergenic
1019549469 7:1594863-1594885 TGGATGGGTGGGAGGGTGGATGG - Intergenic
1019549552 7:1595171-1595193 TAGATGGATGGGAGGGTGGATGG - Intergenic
1019567181 7:1690106-1690128 TTGATGGATGGGCGGGTGGATGG + Intronic
1019588148 7:1815736-1815758 TAGCAGGGTGGGCGGGAGGAGGG - Intergenic
1019775993 7:2912619-2912641 TGGATGGGTAGGTGGGTGGGTGG - Intronic
1019776000 7:2912635-2912657 TAGATGGGTGGGTGGATGGATGG - Intronic
1019776040 7:2912770-2912792 TGGATGGATAGGTGGGTGGATGG - Intronic
1021855213 7:24848670-24848692 TAGAGGGGAAGGAGGCTGGCAGG + Intronic
1022204856 7:28153903-28153925 TAGAGGGGCAGGTAGGTGGAGGG - Intronic
1022460103 7:30596369-30596391 TGGAGTGGAAGGTGGGTGGAGGG - Intronic
1022516300 7:30976920-30976942 TAGATGAGTGGGTGGGTGGATGG - Intronic
1022941904 7:35249636-35249658 GAGAAGGTTTGGCGGGTGGAGGG - Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023553022 7:41389198-41389220 TGGGTGGGTAGGTGGGTGGATGG + Intergenic
1023664132 7:42502750-42502772 TAGAGGGATAGAGGGATGGAGGG - Intergenic
1026161144 7:67869966-67869988 TAGATGGGTGGATGGGTGGATGG + Intergenic
1026161198 7:67870206-67870228 TAGATGGGTGGGTGGATGGATGG + Intergenic
1026828618 7:73598461-73598483 TGGATGGGTGGGCTGGTGGATGG - Intronic
1026904217 7:74053689-74053711 TAGATGGGTGGGTGGATGGATGG + Intronic
1026907568 7:74071290-74071312 TAGATGGGTGGGTGGGTGGATGG - Intergenic
1027163746 7:75820621-75820643 TAGATGGGTGGGTGGGTGGGTGG - Intronic
1029072867 7:97914097-97914119 TAGATGGGTGGGTGGGTGGGTGG + Intergenic
1029072874 7:97914121-97914143 TAGATGGGTAGGTGGGTGGATGG + Intergenic
1029117011 7:98242763-98242785 TGGATGGGTGGGTGGGTGGATGG - Intronic
1029604815 7:101592184-101592206 TAGATGAATAGACGGGTGGATGG - Intergenic
1031922563 7:127612636-127612658 TAAATGGGTAGCTGGGTGGATGG + Intronic
1031922599 7:127612803-127612825 TAAATGGGTAGCTGGGTGGATGG + Intronic
1032434300 7:131887656-131887678 TGGAGGGGTGGATGGGTGGATGG - Intergenic
1032438352 7:131920901-131920923 TGGATGTGTAGGTGGGTGGATGG + Intergenic
1032855348 7:135829204-135829226 GAGAGGGGCTGGCTGGTGGAGGG + Intergenic
1033673167 7:143511995-143512017 TGGAGGAGGAGTCGGGTGGAAGG + Intergenic
1034386485 7:150744964-150744986 AGGAGGGGTAGTGGGGTGGAGGG - Intronic
1034460988 7:151197991-151198013 TAGAAGGGTTGGTGGATGGATGG + Intronic
1034461061 7:151198307-151198329 TAGAAGGGTGGGTAGGTGGATGG + Intronic
1034560209 7:151875669-151875691 TAGCGGGGTAGGGCGGTGGGAGG - Intronic
1035048030 7:155981824-155981846 TAGATGGGTGGGTGGATGGATGG - Intergenic
1035058449 7:156052014-156052036 TGGAGGGATAGATGGGTGGATGG - Intergenic
1035058458 7:156052054-156052076 TGGAGGGATAGATGGGTGGATGG - Intergenic
1035058489 7:156052170-156052192 TGGAGGGATAGATGGGTGGATGG - Intergenic
1035225521 7:157430266-157430288 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1035225611 7:157430542-157430564 TGGATGGGTGGGAGGGTGGATGG - Intergenic
1035225621 7:157430566-157430588 TGGATGGGTAGGTGGATGGATGG - Intergenic
1035278838 7:157764951-157764973 TGGATGGGTGGGTGGGTGGATGG - Intronic
1035278985 7:157765600-157765622 TGGATGGGTAGGTGGGTGGATGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035750585 8:1993417-1993439 TGGATGGGTGGGTGGGTGGATGG - Intronic
1036187779 8:6639182-6639204 TGGATGGGTAGACGGGTGCATGG + Intronic
1036187786 8:6639206-6639228 TAGATGGGTAGATGGGTGGATGG + Intronic
1036428976 8:8672005-8672027 TAGATGGGTGGGTGGATGGATGG + Intergenic
1036584076 8:10106882-10106904 TAGAGGGGTAGGCGGGTGGAGGG - Intronic
1036624791 8:10460530-10460552 TAGAGACTTAGGCGGGTGGTGGG + Intergenic
1036897022 8:12644276-12644298 TAGATAGGTAGGTGGGTGGATGG + Intergenic
1037709228 8:21342355-21342377 TGGAGGGGTGGAGGGGTGGAGGG + Intergenic
1037921323 8:22808196-22808218 TAGATGGGTGGGTGGATGGATGG - Intronic
1038007568 8:23445551-23445573 AAAAGGGGTAGGGAGGTGGATGG - Intronic
1038064068 8:23943665-23943687 AAGAGGGGAAGGTGGGAGGAAGG - Intergenic
1038190360 8:25314556-25314578 TAGATGGGTGGGTGGGTGGGTGG - Intronic
1038190409 8:25314741-25314763 TGGATGGGTGGGTGGGTGGAGGG - Intronic
1038190418 8:25314761-25314783 TGGATGGATAGGTGGGTGGATGG - Intronic
1038486723 8:27940714-27940736 CAGATGGGTGGGTGGGTGGATGG - Intronic
1038977367 8:32715192-32715214 CAGAGGCTGAGGCGGGTGGATGG - Intronic
1039111035 8:34040881-34040903 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1039846658 8:41330302-41330324 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1040584397 8:48726287-48726309 TGGATGGATAGGTGGGTGGATGG - Intronic
1040906368 8:52473200-52473222 TAGATGGGTGGGTGGGTGGATGG + Intergenic
1041939429 8:63370568-63370590 TAGATGGGTGCGTGGGTGGATGG - Intergenic
1042634674 8:70860655-70860677 TATAGGGGTAGGGGTGGGGATGG - Intergenic
1042964261 8:74334262-74334284 TGGATGGGTAGGTGGGTGCAGGG - Intronic
1044444093 8:92253548-92253570 TTGTGGGGTGGGCGGGGGGAGGG + Intergenic
1044657902 8:94567344-94567366 AAGAGGCTTAGGCGGGAGGACGG - Intergenic
1045432182 8:102124302-102124324 TCCAGGGGGAGGCGGGCGGAGGG - Intronic
1047215925 8:122876047-122876069 TGGATGGGTAGGTGGATGGATGG - Intronic
1047215930 8:122876063-122876085 TGGAGGGATGGGTGGGTGGATGG - Intronic
1048296957 8:133221433-133221455 TAGATAGATGGGCGGGTGGATGG + Intronic
1048427032 8:134332623-134332645 TAGATGGGTGGGTGGGTGGATGG - Intergenic
1048427039 8:134332639-134332661 TAGATGGGTGGGTGGGTAGATGG - Intergenic
1048427041 8:134332647-134332669 TAGATGGGTAGATGGGTGGGTGG - Intergenic
1048427053 8:134332683-134332705 TGGATGGGTGGGGGGGTGGATGG - Intergenic
1048979728 8:139696866-139696888 TAGATGGGTAGGTGGATGGATGG + Intronic
1048979878 8:139697476-139697498 TAGCTGGGTGGGTGGGTGGATGG + Intronic
1048989514 8:139753052-139753074 TAGATGGGTGGGTGGGTGGATGG - Intronic
1048989578 8:139753319-139753341 TAGATGGGTGGATGGGTGGATGG - Intronic
1049008329 8:139871796-139871818 TGGGTGGGTAGGTGGGTGGATGG + Intronic
1049008395 8:139872113-139872135 TGGATGGGTGGGCTGGTGGATGG + Intronic
1049008446 8:139872337-139872359 TAGATGCGTAGGCTGGTGGATGG + Intronic
1049008532 8:139872661-139872683 TGGATGGGTGGGCTGGTGGATGG + Intronic
1049129603 8:140826674-140826696 GGGAGGCGGAGGCGGGTGGATGG + Intronic
1049155887 8:141066563-141066585 TAGATGGGTAGATGGATGGATGG - Intergenic
1049223474 8:141438540-141438562 TGGAGGGATATGTGGGTGGACGG + Intergenic
1049223551 8:141438866-141438888 TAGATGGATGGGTGGGTGGATGG + Intergenic
1049321271 8:141997826-141997848 TGGAAGGGCAGGTGGGTGGATGG - Intergenic
1049348242 8:142150335-142150357 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1049348256 8:142150399-142150421 TAGATGGGTATATGGGTGGATGG + Intergenic
1049359786 8:142207024-142207046 TAGATGGGTGGGTGGATGGATGG + Intergenic
1049359915 8:142207503-142207525 TAGAGGGATAGATGGGTGGGTGG + Intergenic
1049359944 8:142207626-142207648 TAGAGGGATAGATGGGTGGGTGG + Intergenic
1049359946 8:142207634-142207656 TAGATGGGTGGGTGGATGGATGG + Intergenic
1049364554 8:142230820-142230842 TGGATGGATAGGTGGGTGGATGG - Intronic
1049364559 8:142230836-142230858 TTGATGGGTAGATGGGTGGATGG - Intronic
1049372036 8:142272556-142272578 TAGACGGGTGGGTGGATGGAAGG - Intronic
1049372045 8:142272588-142272610 TAGATGGGTGGGTGGATGGAAGG - Intronic
1049375013 8:142285269-142285291 TGGATGGGTAGGTGGATGGATGG + Intronic
1049375019 8:142285289-142285311 TGGATGGGTAGGTGGATGGATGG + Intronic
1049375048 8:142285393-142285415 TGGATGGGTGGGTGGGTGGATGG + Intronic
1049400886 8:142426711-142426733 TTGGTGGGTAGGCGGGTAGAGGG + Intergenic
1049477064 8:142801739-142801761 TAAAAGGGTGGGTGGGTGGATGG + Intergenic
1049576423 8:143391950-143391972 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1050503704 9:6325786-6325808 TAGAGGGGGAAGTGGGTGGGTGG - Intergenic
1051563888 9:18474072-18474094 CCGAGGGGTGGGTGGGTGGATGG - Exonic
1051769131 9:20557259-20557281 TAGTGGGGTAGTGGGGTTGAGGG + Intronic
1053152077 9:35749586-35749608 AGGAGGGGTAGGCGGGTGGGAGG - Intronic
1053174644 9:35913082-35913104 TAGATGGATGGGTGGGTGGATGG - Intergenic
1053664146 9:40305738-40305760 TAGAGTGGTGGGAGGGTGGGTGG + Intronic
1053665113 9:40311943-40311965 TAGAGTGGTGGGAGGGTGGGTGG + Intronic
1053799826 9:41757352-41757374 TAGATGGGTAGGTGGATGGGTGG + Intergenic
1053800556 9:41761390-41761412 GAGAGGCTGAGGCGGGTGGATGG + Intergenic
1053802936 9:41775593-41775615 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1053802943 9:41775609-41775631 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1053802950 9:41775625-41775647 TATATGGATGGGCGGGTGGATGG - Intergenic
1053913545 9:42928475-42928497 TAGAGGTGGGGGCTGGTGGAAGG + Intergenic
1053916007 9:42946081-42946103 TAGGGTGGTAGGAGGGTGGGGGG + Intergenic
1054144636 9:61553445-61553467 GAGAGGCTGAGGCGGGTGGATGG - Intergenic
1054145272 9:61557120-61557142 TAGGTGGGTGGGTGGGTGGATGG - Intergenic
1054145385 9:61557581-61557603 TAGATGGGTAGGTGGATGGGTGG - Intergenic
1054188234 9:61969407-61969429 TAGATGGGTAGGTGGATGGGTGG + Intergenic
1054188344 9:61969859-61969881 TAGGTGGGTGGGTGGGTGGATGG + Intergenic
1054188987 9:61973542-61973564 GAGAGGCTGAGGCGGGTGGATGG + Intergenic
1054191241 9:61986939-61986961 TGGATGGGTGGGTGGGTGGATGG - Intergenic
1054376274 9:64451973-64451995 TAGAGTGGTGGGAGGGTGGGTGG + Intergenic
1054459102 9:65453053-65453075 TAGATGGGTAGATGGGTGGATGG + Intergenic
1054464955 9:65487977-65487999 TAGGTGGGTGGGTGGGTGGATGG - Intergenic
1054519503 9:66064341-66064363 TAGAGTGGTGGGAGGGTGGGTGG - Intergenic
1054520469 9:66070547-66070569 TAGAGTGGTGGGAGGGTGGGTGG - Intergenic
1054647128 9:67600778-67600800 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1054650181 9:67618762-67618784 TAGGTGGGTGGGTGGGTGGATGG - Intergenic
1054650280 9:67619169-67619191 TAGATGGGTAGGTGGATGGGTGG - Intergenic
1055641144 9:78319948-78319970 TAGATGGGTAGGTGGGTGGATGG - Intronic
1055641211 9:78320285-78320307 TGGATGGGTAGGTGAGTGGATGG - Intronic
1055641254 9:78320475-78320497 TAGATGGGTAGATAGGTGGAAGG - Intronic
1055641292 9:78320639-78320661 TGGATGGGTGGGTGGGTGGATGG - Intronic
1056682442 9:88731084-88731106 TGGATGGGTAGGTGGATGGATGG - Intergenic
1057273249 9:93662521-93662543 TGGATGGGTGGGCGGATGGATGG + Intronic
1057305208 9:93908348-93908370 CAGGGGGGTAGGTGGGTGGGTGG + Intergenic
1058456249 9:105140750-105140772 GAGAGGGGTAGGAGGGAGCAGGG + Intergenic
1058694513 9:107548026-107548048 TGGAGGGGAAGTCGGGTGAAAGG + Intergenic
1059145191 9:111893713-111893735 TAGTGGAGGAGGCTGGTGGAGGG - Intergenic
1060877266 9:127092400-127092422 TAGAGGGGAGCGCCGGTGGATGG - Intronic
1061256697 9:129457591-129457613 TAGAAGGGTGGGTGGATGGATGG + Intergenic
1061399522 9:130360797-130360819 TGGAGGGGTGGATGGGTGGATGG - Intronic
1061402027 9:130373650-130373672 TGGATAGGTAGGTGGGTGGATGG + Intronic
1061402048 9:130373746-130373768 TAGATGGATAGGTAGGTGGATGG + Intronic
1061402053 9:130373770-130373792 TAGATGGATAGGTAGGTGGATGG + Intronic
1061402058 9:130373794-130373816 TAGATGGATAGGTAGGTGGATGG + Intronic
1061490993 9:130944374-130944396 TGGAGGGGTGGAGGGGTGGAGGG + Intergenic
1061490996 9:130944382-130944404 TGGAGGGGTGGAGGGGTGGAAGG + Intergenic
1061491006 9:130944406-130944428 TAGAGGGCTGGAGGGGTGGAGGG + Intergenic
1061491022 9:130944446-130944468 TGGAGGGGTGGAGGGGTGGAGGG + Intergenic
1061491025 9:130944454-130944476 TGGAGGGGTGGAGGGGTGGAAGG + Intergenic
1061491028 9:130944462-130944484 TGGAGGGGTGGAAGGGTGGAAGG + Intergenic
1061491039 9:130944486-130944508 TGGAGGGGTGGAAGGGTGGAGGG + Intergenic
1061491046 9:130944502-130944524 TGGAGGGGTGGAAGGGTGGAGGG + Intergenic
1061491053 9:130944518-130944540 TGGAGGGGTGGAAGGGTGGAGGG + Intergenic
1061491061 9:130944534-130944556 TGGAGGGGTGGAGGGGTGGAGGG + Intergenic
1061491065 9:130944542-130944564 TGGAGGGGTGGAGGGGTGGAGGG + Intergenic
1061491068 9:130944550-130944572 TGGAGGGGTGGAGGGGTGGAAGG + Intergenic
1061491072 9:130944558-130944580 TGGAGGGGTGGAAGGGTGGAGGG + Intergenic
1061491079 9:130944574-130944596 TGGAGGGGTGGAAGGGTGGAGGG + Intergenic
1061584500 9:131557159-131557181 TAGAGGGATGGGTGAGTGGATGG - Intergenic
1061846935 9:133393261-133393283 TGGATGGGTGGGCGGGTGGATGG + Intronic
1061846948 9:133393309-133393331 TAGATGGGTGGGTGAGTGGATGG + Intronic
1061846964 9:133393373-133393395 TAGATGGGTAGGTGAGTAGATGG + Intronic
1061847031 9:133393642-133393664 TGGATGGGTGGGTGGGTGGATGG + Intronic
1061932189 9:133838876-133838898 TAGATGGGTGGGTGGGTGGATGG + Intronic
1061932230 9:133839013-133839035 TGGGTGGGTAGGTGGGTGGATGG + Intronic
1061938322 9:133870945-133870967 CAGATGGGTAGACGGGTGGGTGG + Intronic
1061963357 9:133999097-133999119 TGGAGGGATAGGTGGATGGATGG - Intergenic
1062051889 9:134451750-134451772 TAGATGGGTAGGTGGATGGATGG - Intergenic
1062051912 9:134451854-134451876 TAGATGGGTAGATGGATGGATGG - Intergenic
1062089672 9:134668939-134668961 TGGATGGGTGGGTGGGTGGAAGG - Intronic
1062112355 9:134789005-134789027 TAGACAGGTAGGTGGGTGGTTGG + Intronic
1062117865 9:134818783-134818805 CAGAGGGGTTGCCGAGTGGAGGG + Intronic
1062433957 9:136538255-136538277 TGCAGGGGTGGGAGGGTGGAGGG - Intronic
1062484843 9:136769664-136769686 TGGAGGGGTAGCGGGGTGGCGGG - Intergenic
1062520720 9:136956784-136956806 TAGATGGGTGGGTGGATGGATGG + Intronic
1062520956 9:136957625-136957647 ATGATGGGTAGGTGGGTGGATGG + Intronic
1062567011 9:137167964-137167986 CAGCGGGGTGGGCGGGCGGACGG - Exonic
1062698351 9:137886669-137886691 GAGAGCAGTCGGCGGGTGGACGG + Intronic
1062698357 9:137886699-137886721 GAGAGCAGTCGGCGGGTGGACGG + Intronic
1203624602 Un_KI270750v1:1394-1416 AAGAGGGAGAGGTGGGTGGAGGG + Intergenic
1185495219 X:549585-549607 TAGATGGGTGGGTGGATGGATGG - Intergenic
1185495290 X:549979-550001 TAGATGGGTGGGTGGATGGATGG - Intergenic
1185497342 X:565528-565550 TGGATGGGTGGGTGGGTGGATGG + Intergenic
1185580937 X:1211230-1211252 TGGATGGGTGGGTGGGTGGATGG + Intronic
1185583216 X:1226702-1226724 TAGATGGGTGAGTGGGTGGATGG + Intergenic
1185583230 X:1226774-1226796 TAGATGGGTTGGTGGATGGATGG + Intergenic
1185583415 X:1227599-1227621 TGGATGGGTAGGCGGATGGATGG + Intergenic
1185603668 X:1355179-1355201 AGGAGGGGGAGGAGGGTGGAGGG + Intronic
1185603676 X:1355195-1355217 TGGAGGGGGAGGAGGGTGGAGGG + Intronic
1185603684 X:1355211-1355233 TGGAGGGGGAGGAGGGTGGAGGG + Intronic
1185616210 X:1423764-1423786 TAGATGGATGGGTGGGTGGACGG - Intronic
1185616240 X:1423880-1423902 TGGATGGGTAGGTGGATGGATGG - Intronic
1185616272 X:1424038-1424060 TGGATGGGTAGGTGGGTGGGTGG - Intronic
1185616465 X:1424850-1424872 TGGATGGGTGGGTGGGTGGATGG - Intronic
1185625009 X:1475044-1475066 TAGATGGATAGACGGGTGGATGG + Intronic
1185625055 X:1475236-1475258 TGGATGGGTAGGTGGATGGATGG + Intronic
1185625068 X:1475280-1475302 TAGATGGGTGGGTGGGTAGATGG + Intronic
1185639175 X:1577250-1577272 TAGATGGGTGGGTGGGTGAATGG + Intergenic
1185694452 X:2184776-2184798 TAGATGGGTAGATGGATGGATGG - Intergenic
1185695828 X:2193731-2193753 TAGGTGGGTGGGTGGGTGGATGG - Intergenic
1185711125 X:2304254-2304276 TGGATGGGTGGGTGGGTGGATGG + Intronic
1185750473 X:2607045-2607067 GAGATGGGTGGGTGGGTGGATGG - Intergenic
1185755480 X:2650020-2650042 TGGATGGGTAGACAGGTGGATGG + Intergenic
1185755533 X:2650314-2650336 TAGATGGGTGGATGGGTGGATGG + Intergenic
1185759678 X:2680942-2680964 TAGATGGGTGGGTGGGTAGATGG - Intergenic
1185867839 X:3639218-3639240 TGAAGGGGTGGGTGGGTGGATGG + Intronic
1185867847 X:3639242-3639264 TGAAGGGGTAGGTGGGTGGATGG + Intronic
1185867867 X:3639290-3639312 TGGGGGGGTCGGGGGGTGGATGG + Intronic
1185867928 X:3639446-3639468 TGAAGGGGTGGGGGGGTGGATGG + Intronic
1185867972 X:3639565-3639587 TTGGGGGGTAGGTGGGTGGATGG + Intronic
1185883106 X:3758519-3758541 TGGATGGGTAGGGGGGTGGATGG - Intergenic
1185883181 X:3758815-3758837 TGGATGGGTGGGCGGATGGATGG - Intergenic
1186284221 X:8026851-8026873 AAGATGAGTAGGTGGGTGGATGG - Intergenic
1186338986 X:8622986-8623008 TAGATGGATAGCCGGATGGATGG + Intronic
1186481894 X:9902300-9902322 TAGAGGGGAGGGCAAGTGGATGG + Intronic
1186724755 X:12345195-12345217 TAGATGGGTGGGTGGGTGGATGG + Intronic
1187310715 X:18138652-18138674 CAGAGGGGTAGGGGTGTGGGAGG + Intergenic
1189436605 X:40998359-40998381 GAGAGAGGTTGGCAGGTGGATGG - Intergenic
1190377020 X:49797993-49798015 CAGAGGAGTAGGGGAGTGGAAGG - Intergenic
1192134669 X:68586024-68586046 TGGAGGGGGAGCCTGGTGGAAGG - Intergenic
1192211509 X:69130828-69130850 TGGTGGGGTAGAAGGGTGGAGGG - Intergenic
1192736043 X:73850689-73850711 TAGGGGGGTAGGGGGGTAGGGGG + Intergenic
1193378820 X:80794264-80794286 TAGAGGCCGAGGCAGGTGGATGG + Intronic
1193807275 X:86010183-86010205 TAGAGGGGTGGGGGGGTAGGGGG + Intronic
1193807281 X:86010191-86010213 TGGGGGGGTAGGGGGGTGGGGGG + Intronic
1195381294 X:104273481-104273503 TGGAGGTCTAGGCGGGTAGATGG - Intergenic
1195659360 X:107362766-107362788 TACAGAGGTAGAGGGGTGGAGGG + Intergenic
1196361258 X:114862908-114862930 TAGAAGGGTAGGGGAGTTGAGGG - Intronic
1196632172 X:117954395-117954417 TAGATAGGTAGACGGATGGATGG + Intronic
1196942693 X:120793006-120793028 GAGAGGCCAAGGCGGGTGGATGG - Intergenic
1197770041 X:130083797-130083819 TGGATGGGTGGGTGGGTGGATGG + Intronic
1198051392 X:132956341-132956363 TAGGGGGGAAAGCGGGGGGAGGG + Intronic
1198077999 X:133212823-133212845 AAGAGGGGGAGGCGGGGAGAGGG + Intergenic
1198185636 X:134251614-134251636 GAGAGAGGTAGTGGGGTGGAGGG - Intergenic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1198686435 X:139232665-139232687 TGGATGGGTTGGTGGGTGGATGG - Intergenic
1199422664 X:147662586-147662608 TGGAAGGGTGGGAGGGTGGAAGG - Intergenic
1200909210 Y:8515938-8515960 TAGAGGGGGTGGAGTGTGGAAGG - Intergenic
1201708368 Y:16961802-16961824 TACAGGGGTGGGGGGTTGGAGGG + Intergenic
1201866288 Y:18658947-18658969 TGGATGGGTAGGAGTGTGGATGG + Intergenic