ID: 1036585972

View in Genome Browser
Species Human (GRCh38)
Location 8:10124030-10124052
Sequence CTCTGCAATCCCAAGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 165}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036585972_1036585982 3 Left 1036585972 8:10124030-10124052 CCTTTGACCTTGGGATTGCAGAG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1036585982 8:10124056-10124078 GAGGGGCTTCTGGTGTGGGTGGG No data
1036585972_1036585980 -1 Left 1036585972 8:10124030-10124052 CCTTTGACCTTGGGATTGCAGAG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1036585980 8:10124052-10124074 GGTCGAGGGGCTTCTGGTGTGGG No data
1036585972_1036585985 17 Left 1036585972 8:10124030-10124052 CCTTTGACCTTGGGATTGCAGAG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1036585985 8:10124070-10124092 GTGGGTGGGGCTGCAGCCTTGGG No data
1036585972_1036585981 2 Left 1036585972 8:10124030-10124052 CCTTTGACCTTGGGATTGCAGAG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1036585981 8:10124055-10124077 CGAGGGGCTTCTGGTGTGGGTGG No data
1036585972_1036585984 16 Left 1036585972 8:10124030-10124052 CCTTTGACCTTGGGATTGCAGAG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1036585984 8:10124069-10124091 TGTGGGTGGGGCTGCAGCCTTGG No data
1036585972_1036585986 20 Left 1036585972 8:10124030-10124052 CCTTTGACCTTGGGATTGCAGAG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1036585986 8:10124073-10124095 GGTGGGGCTGCAGCCTTGGGTGG No data
1036585972_1036585979 -2 Left 1036585972 8:10124030-10124052 CCTTTGACCTTGGGATTGCAGAG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1036585979 8:10124051-10124073 AGGTCGAGGGGCTTCTGGTGTGG No data
1036585972_1036585983 4 Left 1036585972 8:10124030-10124052 CCTTTGACCTTGGGATTGCAGAG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1036585983 8:10124057-10124079 AGGGGCTTCTGGTGTGGGTGGGG No data
1036585972_1036585978 -7 Left 1036585972 8:10124030-10124052 CCTTTGACCTTGGGATTGCAGAG 0: 1
1: 0
2: 2
3: 21
4: 165
Right 1036585978 8:10124046-10124068 TGCAGAGGTCGAGGGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036585972 Original CRISPR CTCTGCAATCCCAAGGTCAA AGG (reversed) Intronic
902110900 1:14077366-14077388 CTTTGCCTTCCCAAAGTCAAAGG - Intergenic
902692802 1:18120666-18120688 CTCTGCAGTCCCAGGCTCCATGG + Intronic
903858300 1:26350243-26350265 ACCTGGAAGCCCAAGGTCAAGGG - Intronic
904574875 1:31498941-31498963 CTCTGCTATACCAAGGAGAAAGG + Intergenic
907786456 1:57617590-57617612 CTCTCCAATGCCAGTGTCAAAGG - Intronic
915384544 1:155478152-155478174 GTCTGCAATCCCAAGGCCAATGG + Exonic
916337277 1:163687066-163687088 CTCTCCAAACTCAAGGCCAAGGG - Intergenic
918125408 1:181579463-181579485 CTCCCCTATCCCATGGTCAAGGG + Intronic
920050900 1:203164517-203164539 CTCTGCACTCCCAAGCTAACTGG - Intronic
920380010 1:205529692-205529714 CTCTCCACCCCCAAGGCCAAGGG + Intronic
921273177 1:213490797-213490819 CTCCTCAATCCCAAAGACAAAGG - Intergenic
921347468 1:214201642-214201664 GTCTGCACTCCCATGGTCATTGG + Intergenic
921812661 1:219532275-219532297 TTGTGCAATGCCAAGGTTAAGGG - Intergenic
924863566 1:247952989-247953011 ATCTCCAATCCCAGGGTCATTGG - Intronic
1063084186 10:2800191-2800213 GGCTGCAAGTCCAAGGTCAAGGG - Intergenic
1064538420 10:16381782-16381804 CTCTGCCTTCCCAGGTTCAAGGG - Intergenic
1067035977 10:42917459-42917481 CTTTGCACTCCCATGTTCAAGGG + Intergenic
1067476084 10:46567339-46567361 CTCTGCACTCCCCTGGTCAGCGG - Intergenic
1067618654 10:47774441-47774463 CTCTGCACTCCCCTGGTCAGTGG + Intergenic
1068246498 10:54378006-54378028 CTCCCCAACCCCAAGCTCAAGGG + Intronic
1069559042 10:69416791-69416813 CTCTGGAGTCCACAGGTCAATGG + Exonic
1069980260 10:72247591-72247613 CTCTGCAATGCCAGGGTAGAAGG + Intergenic
1072741330 10:97911720-97911742 CTCTGCCAGGCCAATGTCAAAGG + Intronic
1073119545 10:101113260-101113282 CTCTGGCCTCCCAGGGTCAAAGG - Intronic
1073588419 10:104732939-104732961 CTCTGGTATCTGAAGGTCAAGGG + Intronic
1074117971 10:110471913-110471935 CTCAGCAATCCCATGCTCAGAGG + Intergenic
1074561915 10:114542701-114542723 CTCAGGAATCCCAAGGGAAATGG + Intronic
1075316759 10:121459365-121459387 CTCTGCTACCCCAAGGTGACTGG - Intergenic
1075502903 10:122994074-122994096 CTCGGCCATCCCATAGTCAAAGG - Exonic
1077436528 11:2542030-2542052 TTCTGCAATCCCAGGCTCCAGGG - Intronic
1079238238 11:18704644-18704666 CTCTGCCAACCCAAGATTAAGGG - Exonic
1080298693 11:30759503-30759525 CTCTACAATCTCAAGATCCAGGG - Intergenic
1084174455 11:67416082-67416104 CTCTCCACTCCCAAAGTCTAGGG + Exonic
1084384742 11:68836230-68836252 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
1084589346 11:70081128-70081150 CTCTTCATTCCCAAGTTCAAGGG + Intronic
1086190536 11:84073546-84073568 CTCTTCATCCCCTAGGTCAAGGG - Intronic
1087693269 11:101346740-101346762 CTCTGCATTCCCAGTGTCTAAGG + Intergenic
1091140197 11:133228066-133228088 ATCTCCCATCCCAAGGACAAAGG - Intronic
1097977106 12:65698298-65698320 CCATGAAATCACAAGGTCAAGGG - Intergenic
1098459085 12:70712074-70712096 CTCTGAAATTCCAAGGTGAAAGG - Intronic
1100549764 12:95636218-95636240 CTCTGCAATACCTTCGTCAAAGG - Intergenic
1102214710 12:111152471-111152493 CTCTGCCAACACAAGGCCAATGG - Intronic
1104322411 12:127764234-127764256 TTTTGCAATCCCAGGGTCAATGG - Intergenic
1104654767 12:130566062-130566084 ATCTGCCTGCCCAAGGTCAAAGG + Intronic
1113034250 13:106031494-106031516 CTCAGCAAGCCCCAGGTGAAAGG - Intergenic
1113218335 13:108069467-108069489 CTCTATAATCCAAAGCTCAACGG - Intergenic
1114656593 14:24319411-24319433 CTCTCCAAGCCCAAGTTCAGTGG - Exonic
1116416860 14:44688485-44688507 TTCTGGAATCCCCATGTCAAAGG - Intergenic
1119539567 14:75429073-75429095 CTCTGCCATCCCAGGGTCCAGGG - Intronic
1202888201 14_KI270722v1_random:128485-128507 CTCTGCAATCCTAGGGGCAGTGG + Intergenic
1126225422 15:46263289-46263311 CTTTGCAATCCTCAGGTCAGGGG - Intergenic
1129363596 15:75040742-75040764 CTCTGCCTTCCCAGGCTCAAGGG + Intronic
1135004697 16:18809348-18809370 GCCTGCAACCCCAGGGTCAAGGG - Exonic
1136277522 16:29187663-29187685 GGCTGCAAGTCCAAGGTCAAGGG + Intergenic
1140520514 16:75576987-75577009 CTCTTAAATGCCAAGGACAAGGG - Intronic
1140877394 16:79165254-79165276 CTCCGCAATGGCAAGGTCATTGG - Intronic
1142081899 16:88153705-88153727 GGCTGCAAGTCCAAGGTCAAGGG + Intergenic
1147443440 17:40461202-40461224 GTCTTCAGGCCCAAGGTCAAAGG - Intergenic
1148920370 17:51026392-51026414 CTCAGCAATCCCAAGGTTTCAGG + Intronic
1150820640 17:68431502-68431524 GACTTCATTCCCAAGGTCAAAGG + Intronic
1151273542 17:73015419-73015441 CTCTCTGATCCCAAGCTCAAGGG + Intronic
1152618555 17:81349318-81349340 CTCGCCAAGCCCAAAGTCAAGGG - Intergenic
1157712158 18:49857612-49857634 CACCCCAGTCCCAAGGTCAAGGG - Intronic
1158225022 18:55192009-55192031 CTCTGCAATCCCAGGGACTTGGG - Intergenic
1160270135 18:77376196-77376218 ATCTGCAAGTCCAAGGTTAATGG - Intergenic
1160448291 18:78943953-78943975 TGCAGCAAACCCAAGGTCAAGGG - Intergenic
1161053822 19:2180026-2180048 CTCTACAAGGCCAATGTCAAAGG - Intronic
1161348348 19:3778888-3778910 CTCTGAAACTCCAAGGGCAATGG - Intronic
1165017074 19:32889204-32889226 CTAGGCACTCCCAGGGTCAAGGG + Intronic
1202663596 1_KI270708v1_random:95280-95302 CTCTGCAATCCTAGGGGCAGTGG + Intergenic
925642017 2:5994428-5994450 CTCTGCACTCCTAAGGCCATGGG + Intergenic
928600185 2:32896902-32896924 CTGTGCCATCCCAAGGTGGAAGG - Intergenic
932320717 2:70820334-70820356 GTCTGCATCCCCAAGGACAAGGG + Intronic
933242027 2:79932366-79932388 CTCTCAAATCCCAAGTTCACTGG - Intronic
934724162 2:96604400-96604422 CTCTGTTATCCAAAGGTCACAGG + Intronic
935333383 2:101993985-101994007 CTCTGCCCTCCCAAGGCCAGTGG + Intronic
938967019 2:136397663-136397685 CTCTGAAATCCCAGAGTCTACGG - Intergenic
941955407 2:171199265-171199287 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
943627894 2:190219103-190219125 TTCTGGAATGCCAAGGTGAATGG - Intronic
944206627 2:197164310-197164332 CTCTGGCAGCACAAGGTCAAAGG + Intronic
946449782 2:219769967-219769989 CTCTGCTACCCAAAGGTAAAGGG - Intergenic
946976756 2:225161552-225161574 CTCTTCAATCCCTAAGTCACAGG + Intergenic
1169763610 20:9124411-9124433 CTCTGAACTCCCAGGCTCAAGGG - Intronic
1172065413 20:32216444-32216466 CTCTGCAATTCCTAGGCCAGGGG - Intronic
1172449570 20:35012446-35012468 CTCCCCAATGCCAAGGTCAAGGG + Intronic
1172818054 20:37705496-37705518 CTCAGTATTCCCAAGGTCATTGG + Intronic
1173499417 20:43541656-43541678 ATCTGCAATGCCAATATCAAGGG + Exonic
1173620339 20:44431411-44431433 CTCTTCACTCCCCAAGTCAAGGG + Exonic
1174124039 20:48289603-48289625 CTCCCCATTCCCAAGGTCAGTGG - Intergenic
1174158254 20:48531272-48531294 CTCTGCTATCCCTAGGCCATTGG - Intergenic
1174379804 20:50149294-50149316 CTCTGTAATCCCCAGGGCAGGGG + Intronic
1176266171 20:64210482-64210504 CTCTGCTGCCCCAAGTTCAAAGG - Intronic
1176718986 21:10378355-10378377 CTCTGCAAAGACAAAGTCAAGGG + Intergenic
1178713821 21:34945369-34945391 GGCTGCAAGGCCAAGGTCAAAGG - Intronic
1180300218 22:11031337-11031359 CTCTGCAAAGACAAAGTCAAGGG + Intergenic
1183251719 22:36734991-36735013 CGCTGCTCTCCCAATGTCAAGGG + Intergenic
1184048578 22:41987910-41987932 CTAGGGAATCCCAAGGTCATGGG - Intronic
949265819 3:2155282-2155304 CTCTGCAATCAGAAGGTAAGAGG - Intronic
953026123 3:39146269-39146291 GTCATCACTCCCAAGGTCAAAGG + Intronic
953034555 3:39200809-39200831 TTCTGCAAGCCCAAGGACTAGGG - Intergenic
954830960 3:53420945-53420967 CTGTGCAATCACAAGGTTCAGGG + Intergenic
955380338 3:58433511-58433533 CTCCGCAAACCCAAGGCCCACGG + Intronic
955787525 3:62555994-62556016 ATCTGCAATCCCAAGGCGAGAGG - Intronic
955982063 3:64536964-64536986 CTGTGCAATCACTAGGTCAAAGG + Intronic
957557263 3:81778825-81778847 CTCAACAAACCCAAGGTCAGAGG - Intergenic
960677924 3:120214866-120214888 CTCTGCAATCCTAAGGTGGATGG + Intronic
961378051 3:126480075-126480097 CTCTGCAAACCCAGGGTCCCTGG - Intergenic
963415202 3:144985987-144986009 CCCTGCGATCCCAAAGACAATGG + Intergenic
963994856 3:151696201-151696223 ATCTGCAAGCCAAATGTCAAAGG + Intergenic
964018666 3:151979530-151979552 CTCTGCAATCCGCAAGCCAAGGG + Intergenic
964084208 3:152796973-152796995 CTCAGCAATCCCACTTTCAAAGG - Intergenic
965687600 3:171321259-171321281 CCCTTAAATTCCAAGGTCAAAGG + Intronic
967432659 3:189404927-189404949 TTCTTCAATTGCAAGGTCAATGG + Intergenic
968756369 4:2418277-2418299 CTCTACAAACCCAAGGTGAGCGG - Exonic
968812752 4:2807509-2807531 CTCTGAAATCTCCAAGTCAATGG - Intronic
970572254 4:17394303-17394325 CACTGCAAGCCCAAGGACAAGGG - Intergenic
970784695 4:19782250-19782272 GTCTGCAATCAAAATGTCAATGG + Intergenic
972584123 4:40420883-40420905 TTCTGAACCCCCAAGGTCAAAGG - Intergenic
976656569 4:87495043-87495065 CACTGCAATCCCCAGTTTAAGGG - Exonic
978279153 4:106988792-106988814 GTCTCCAATCCAAGGGTCAACGG + Intronic
978937922 4:114400217-114400239 ATCTGCAATCCCAGTGCCAAGGG - Intergenic
979756226 4:124343180-124343202 CTCTGCTAGCCCAAGGTCCCTGG + Intergenic
981980986 4:150790916-150790938 ATCTGCAATCAAAAGGTCATAGG + Intronic
982759598 4:159265503-159265525 CTCTGCACTCCCAAGTTGCAGGG - Intronic
985606959 5:862965-862987 ATCTGCAGTCCCAAGCTCAGTGG - Intronic
986256922 5:6108405-6108427 ATCTGCCATCTCAAGGTCATAGG + Intergenic
986612023 5:9578485-9578507 CTCTGGCATCCCCAGCTCAAGGG + Intergenic
988658226 5:33235844-33235866 CCCTGCAATCCAAAGGAGAAAGG - Intergenic
990633606 5:57697888-57697910 CCCTACAGTCACAAGGTCAAGGG + Intergenic
991476741 5:67029267-67029289 CTCTGCATTCCCAAGAGAAATGG + Intronic
996431684 5:123386863-123386885 CTCTGCACTCCCAGGGACACAGG + Intronic
997198924 5:131997984-131998006 CTCTGCCCTCCCCATGTCAAAGG - Intronic
997632848 5:135382788-135382810 CTCTGCTCTCCCAAGGCCAGCGG - Intronic
999037411 5:148367851-148367873 CTCTGCAATCCCAAGGATTCAGG + Intergenic
999111732 5:149127239-149127261 CACAGCAAACCTAAGGTCAAGGG + Intergenic
1000327873 5:160185957-160185979 CTCTGAAATTCCAAGGTCAGGGG - Intergenic
1003431931 6:6047100-6047122 CTCTACAATGCAAAGGGCAATGG - Intergenic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1004992197 6:21150612-21150634 CTGATCAATCCCAAGGTCACTGG - Intronic
1005024087 6:21446356-21446378 CTCTGTAATCGCAAGGGGAAGGG - Intergenic
1005127576 6:22465661-22465683 ATCTTCAATCTCAAGGTTAATGG + Intergenic
1010005910 6:70994772-70994794 CCCTGAAATTCCAAGGTCATAGG + Intergenic
1011779075 6:90766449-90766471 CTCTGCAATTCCAAGGTGAATGG - Intergenic
1013644055 6:112117846-112117868 CTCAGCAATCTCCAGCTCAATGG - Exonic
1015346067 6:132161303-132161325 CTCTGCAATCCCACGGCTAATGG - Intergenic
1016521078 6:144947644-144947666 CTCAGCAATCCCAAGATTAAAGG + Intergenic
1016818117 6:148322548-148322570 CTCTGCAATTTCAGGGTCAGGGG - Intronic
1017376598 6:153776955-153776977 CTCTGAAATACCAAGGACTATGG - Intergenic
1018231678 6:161681897-161681919 GTCTGCAATGCCAAGAGCAAAGG + Intronic
1018712123 6:166504789-166504811 CTCTGCAGTTCCAAGATCAGTGG + Intronic
1019344699 7:523488-523510 CTCACCAAGGCCAAGGTCAAGGG - Intergenic
1019727470 7:2611090-2611112 CTCTGCACTCCCAAGCTCCATGG + Exonic
1019910045 7:4094703-4094725 CGCTGCAATCCCGATGTCAATGG - Intronic
1021149262 7:17129242-17129264 CTGAGAAATCCCAAGGTCAAGGG - Intergenic
1024411668 7:49049960-49049982 CTCTGAACTCCCAAGCTGAAGGG - Intergenic
1026615335 7:71897523-71897545 CTCTGGAAACACAAGGTAAAGGG + Intronic
1026959909 7:74401270-74401292 CTCTGGAACCCCCAGTTCAAGGG + Intronic
1030031189 7:105371158-105371180 CTCTGGGAGCCCAAGGTGAATGG + Intronic
1035698935 8:1623211-1623233 CTTTAAAATCCCAAGGTCACTGG - Intronic
1036585972 8:10124030-10124052 CTCTGCAATCCCAAGGTCAAAGG - Intronic
1037435916 8:18863172-18863194 CTGTCCAAACCCAAGTTCAATGG + Intronic
1040140004 8:43898717-43898739 CTCTGCACTGCCAAGGCCACAGG - Intergenic
1040401585 8:47055402-47055424 CTCTGCAAGGCCAAGGTGAGTGG + Intergenic
1043380883 8:79700827-79700849 CTTTTCTATCACAAGGTCAAAGG - Intergenic
1043401408 8:79888709-79888731 CACTGCACTCCCAGGCTCAAGGG + Intergenic
1045769684 8:105721271-105721293 ATCTGCAAACCCATGTTCAAGGG + Intronic
1048627721 8:136204355-136204377 CTCTGTAAACCTAAGGTCAAGGG - Intergenic
1048806217 8:138243644-138243666 CTCTGCAATCCAAAGATTAATGG + Intronic
1048977451 8:139680832-139680854 CTCTCTGATCCCAAGGTCTAGGG + Intronic
1054859629 9:69936068-69936090 CTCTGCAACCCCAAGTTCTCAGG - Intergenic
1059074729 9:111180700-111180722 CTCTGCACTCCTAAAGGCAAAGG + Intergenic
1059431090 9:114250740-114250762 TTCTGAAATCCCCAGGTCAAAGG - Intronic
1185541579 X:906754-906776 CTCTGCAAAGGCAAAGTCAAGGG - Intergenic
1186437162 X:9552538-9552560 CTCTGTACTCACAAGGTCTATGG - Intronic
1189852304 X:45189706-45189728 CTGTGGAATCCTAAGGGCAAAGG + Intronic
1192156729 X:68752377-68752399 CTATGCAAACCTAAGCTCAAAGG + Intergenic
1192367011 X:70482237-70482259 CTCTGCAATACCCAGGCAAATGG - Intronic
1192847499 X:74921637-74921659 CTTTTCAAACCCAAGGTCATAGG - Intronic
1194619637 X:96154221-96154243 TTGTGCAATCACAAGGTCAAAGG + Intergenic
1195938445 X:110146816-110146838 CTCTGCAAGGCCTAGGTCCAAGG - Intronic
1196944488 X:120810247-120810269 CTCTGCCATACCTATGTCAAAGG - Intergenic
1199501869 X:148516098-148516120 GTCAGCCCTCCCAAGGTCAAAGG + Intronic
1200690873 Y:6305815-6305837 CTCTGCAAGCCCAAGGCCTTGGG + Intergenic
1200691813 Y:6313000-6313022 CTCTGCAATCCCATTGTCTGTGG - Intergenic
1200713896 Y:6515962-6515984 CTCTGCAATCCCATTGTCTATGG + Intergenic
1200950725 Y:8897024-8897046 CTCTGCAATCCCATTGTCTGTGG + Intergenic
1201019929 Y:9645196-9645218 CTCTGCAATCCCATTGTCTATGG - Intergenic
1201043459 Y:9861723-9861745 CTCTGCAATCCCATTGTCTGTGG + Intergenic
1201044399 Y:9868901-9868923 CTCTGCAAGCCCAAGGCCTTGGG - Intergenic