ID: 1036586046

View in Genome Browser
Species Human (GRCh38)
Location 8:10124515-10124537
Sequence CTGGTGCCATAATTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036586043_1036586046 10 Left 1036586043 8:10124482-10124504 CCGTGTGACTCTTATGGAAAATT 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1036586046 8:10124515-10124537 CTGGTGCCATAATTGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036586046 Original CRISPR CTGGTGCCATAATTGGAGCT AGG Intronic
No off target data available for this crispr