ID: 1036588609

View in Genome Browser
Species Human (GRCh38)
Location 8:10147705-10147727
Sequence GTGCTCAACCACCAGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036588606_1036588609 8 Left 1036588606 8:10147674-10147696 CCATCTGCATGGAAAGGCTGTAA 0: 1
1: 0
2: 0
3: 15
4: 201
Right 1036588609 8:10147705-10147727 GTGCTCAACCACCAGCTCACAGG No data
1036588603_1036588609 30 Left 1036588603 8:10147652-10147674 CCTGGCACTGCTCTTGGCATGGC 0: 1
1: 0
2: 4
3: 51
4: 373
Right 1036588609 8:10147705-10147727 GTGCTCAACCACCAGCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036588609 Original CRISPR GTGCTCAACCACCAGCTCAC AGG Intronic
No off target data available for this crispr