ID: 1036590583

View in Genome Browser
Species Human (GRCh38)
Location 8:10164397-10164419
Sequence TTCTCCAAGCTAATGCTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036590579_1036590583 1 Left 1036590579 8:10164373-10164395 CCTTCCCTTGGCTGCTGGCTGGG 0: 1
1: 1
2: 5
3: 42
4: 425
Right 1036590583 8:10164397-10164419 TTCTCCAAGCTAATGCTGTTCGG No data
1036590582_1036590583 -4 Left 1036590582 8:10164378-10164400 CCTTGGCTGCTGGCTGGGTTTCT 0: 1
1: 0
2: 2
3: 31
4: 384
Right 1036590583 8:10164397-10164419 TTCTCCAAGCTAATGCTGTTCGG No data
1036590577_1036590583 2 Left 1036590577 8:10164372-10164394 CCCTTCCCTTGGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 48
4: 416
Right 1036590583 8:10164397-10164419 TTCTCCAAGCTAATGCTGTTCGG No data
1036590581_1036590583 -3 Left 1036590581 8:10164377-10164399 CCCTTGGCTGCTGGCTGGGTTTC 0: 1
1: 1
2: 0
3: 30
4: 259
Right 1036590583 8:10164397-10164419 TTCTCCAAGCTAATGCTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036590583 Original CRISPR TTCTCCAAGCTAATGCTGTT CGG Intronic
No off target data available for this crispr