ID: 1036590712

View in Genome Browser
Species Human (GRCh38)
Location 8:10165536-10165558
Sequence GACAGCAGCACGTTGGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036590710_1036590712 -2 Left 1036590710 8:10165515-10165537 CCAGGCTGGGTGGGGAGAGGGGA 0: 1
1: 3
2: 9
3: 127
4: 994
Right 1036590712 8:10165536-10165558 GACAGCAGCACGTTGGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036590712 Original CRISPR GACAGCAGCACGTTGGTACC TGG Intronic
No off target data available for this crispr