ID: 1036596955

View in Genome Browser
Species Human (GRCh38)
Location 8:10221918-10221940
Sequence TGGCGTGTAATCAGCAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036596949_1036596955 9 Left 1036596949 8:10221886-10221908 CCTGAGGCAGGAGTGGCGGAGGC 0: 1
1: 0
2: 6
3: 38
4: 374
Right 1036596955 8:10221918-10221940 TGGCGTGTAATCAGCAAGGGAGG No data
1036596947_1036596955 10 Left 1036596947 8:10221885-10221907 CCCTGAGGCAGGAGTGGCGGAGG 0: 1
1: 0
2: 2
3: 31
4: 369
Right 1036596955 8:10221918-10221940 TGGCGTGTAATCAGCAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036596955 Original CRISPR TGGCGTGTAATCAGCAAGGG AGG Intronic
No off target data available for this crispr