ID: 1036599516

View in Genome Browser
Species Human (GRCh38)
Location 8:10247523-10247545
Sequence TCTTATGTTTAGAAGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036599514_1036599516 -2 Left 1036599514 8:10247502-10247524 CCAAGGAAATTCTTTTGTCTTTC 0: 1
1: 0
2: 7
3: 59
4: 1024
Right 1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036599516 Original CRISPR TCTTATGTTTAGAAGGAAAA AGG Intronic
No off target data available for this crispr