ID: 1036600045

View in Genome Browser
Species Human (GRCh38)
Location 8:10252389-10252411
Sequence GCCTAACAGAAATCATAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036600045_1036600049 8 Left 1036600045 8:10252389-10252411 CCTGTTTATGATTTCTGTTAGGC 0: 1
1: 0
2: 2
3: 7
4: 151
Right 1036600049 8:10252420-10252442 TTCACCAGTATTGAGTCCTGGGG No data
1036600045_1036600048 7 Left 1036600045 8:10252389-10252411 CCTGTTTATGATTTCTGTTAGGC 0: 1
1: 0
2: 2
3: 7
4: 151
Right 1036600048 8:10252419-10252441 TTTCACCAGTATTGAGTCCTGGG No data
1036600045_1036600047 6 Left 1036600045 8:10252389-10252411 CCTGTTTATGATTTCTGTTAGGC 0: 1
1: 0
2: 2
3: 7
4: 151
Right 1036600047 8:10252418-10252440 TTTTCACCAGTATTGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036600045 Original CRISPR GCCTAACAGAAATCATAAAC AGG (reversed) Intronic
910806995 1:91198435-91198457 ATCTCACAGAAATCATTAACTGG - Intergenic
911017622 1:93351165-93351187 GGCTAACAGATATCAATAACTGG - Intronic
911154321 1:94623849-94623871 GCCTCACAGATTTCACAAACAGG - Intergenic
912092230 1:106093386-106093408 CTCTAACAAATATCATAAACTGG - Intergenic
915786569 1:158619603-158619625 CCCCAAAAGAAATTATAAACAGG - Intronic
919064200 1:192672657-192672679 GCCTAGCAGAAAGCAAAACCTGG + Intergenic
919236697 1:194854834-194854856 GGCTAACAGAAATAATTAGCTGG - Intergenic
920843013 1:209570647-209570669 GCCTAACAAAGGTCACAAACTGG + Intergenic
920895482 1:210044670-210044692 GCCTAATACAAATCATTATCTGG - Intronic
1063975621 10:11413382-11413404 GCCTCAGAGAATTCAGAAACAGG + Intergenic
1066308843 10:34175335-34175357 CACTAGCAGAAAGCATAAACAGG - Intronic
1067528632 10:47054422-47054444 GCCTAATAAAAATAATAATCAGG - Intergenic
1071185745 10:83042575-83042597 ACTTAGCAGAAATCATAATCAGG + Intergenic
1071992605 10:91114611-91114633 GCCTAACAGAAGTTATCAAGGGG + Intergenic
1072368065 10:94734523-94734545 GGATCACAGAAATCATAAAGAGG + Intronic
1074035740 10:109736446-109736468 GCTAAACAGAAAGCAGAAACTGG - Intergenic
1074929527 10:118109751-118109773 GCATCAGCGAAATCATAAACAGG - Intergenic
1076642081 10:131925022-131925044 ACCTATCAGAGATAATAAACAGG - Intronic
1078670120 11:13357180-13357202 GCCCAACAGAACTCTTAGACAGG - Intronic
1078987910 11:16612949-16612971 GCCTAAGAGAAACTGTAAACGGG + Intronic
1079713860 11:23719435-23719457 GCTTACCAGAAACCATAAATGGG - Intergenic
1080355188 11:31435781-31435803 TCATAACAGAAATGAGAAACTGG - Intronic
1085681511 11:78579441-78579463 GCCAAACAAAAATAATAATCAGG - Intergenic
1086169390 11:83818476-83818498 GTCTAACAGAAGTAATAAGCAGG - Intronic
1095756070 12:45768588-45768610 GCCTAAGAGTATTCAAAAACAGG + Intronic
1097571117 12:61334158-61334180 GCTTAACAGGAAGCATAAATGGG + Intergenic
1101311383 12:103583313-103583335 AACTACTAGAAATCATAAACGGG + Intergenic
1103081939 12:118031161-118031183 ACCTAACAGAAACCAAACACAGG - Exonic
1103311292 12:120011041-120011063 GCCTAACAGGAATTAAAAGCTGG + Intronic
1103633508 12:122283025-122283047 TCCTAACAGAAATCCTGCACTGG + Intronic
1103754098 12:123189480-123189502 TCCTAACAGCAATGACAAACTGG + Intronic
1104511423 12:129382915-129382937 GACCAACAGAAAACACAAACAGG - Intronic
1106551069 13:30771452-30771474 GCCTAAAAGAAATCAGCACCAGG + Intergenic
1107210609 13:37849639-37849661 GCCTAAAACAGATCTTAAACTGG + Intronic
1111246358 13:85547176-85547198 GCTTAACAGGAATCATGACCAGG + Intergenic
1111818902 13:93190254-93190276 GCCTACCACAACTCATAAAGTGG + Intergenic
1114371936 14:22099296-22099318 ACCTAACAGGATGCATAAACAGG + Intergenic
1114484319 14:23054106-23054128 GTCTAAGAGAAAGCATTAACAGG + Intronic
1116075615 14:40106419-40106441 GCTTAACAGAAAGCATAACTGGG - Intergenic
1117047140 14:51824759-51824781 GCATAAAAGAAATAATAAATTGG - Intergenic
1118808362 14:69256796-69256818 GCCTAAGAGAAATCCTGAAAAGG + Intergenic
1125351592 15:38773250-38773272 GGCTTACTGAAATCATAATCTGG + Intergenic
1127212549 15:56788873-56788895 GGCTAGCAGAAAACAGAAACTGG + Intronic
1135539239 16:23317268-23317290 GCCTGGCTGAAATCATAAAAGGG + Intronic
1135712800 16:24731899-24731921 GCCTAACAGACCTCAGCAACTGG - Intronic
1138631766 16:58301112-58301134 TTCTAACATAATTCATAAACTGG - Intronic
1139504063 16:67390349-67390371 TCCAAACAGAAAGCAAAAACAGG - Exonic
1146252531 17:31361734-31361756 GCAAAACTGAGATCATAAACTGG - Intronic
1146965534 17:37025570-37025592 GCCTCAGAGAAATCACAAAAGGG + Intronic
1150552807 17:66226161-66226183 GGCTAAAAAAAAACATAAACAGG + Intronic
1154035581 18:10798637-10798659 GACATACTGAAATCATAAACTGG - Intronic
1154157532 18:11955663-11955685 ACCTAAAAGAAGTCATTAACAGG - Intergenic
1156148545 18:34216130-34216152 GCCTAACTGAAGTCATAAACAGG + Intronic
1159181222 18:64908078-64908100 ACATAACAGGAATCATAAACAGG - Intergenic
1161931852 19:7345871-7345893 GCCTGAAAGAAATAATCAACTGG + Intergenic
1162671223 19:12259456-12259478 GCATAACAAAAATCATAAAAAGG - Intronic
925809441 2:7684869-7684891 GCCTAAGAAGAATCACAAACTGG + Intergenic
927378445 2:22447493-22447515 AGCTAAAAGAAATCATAAAAAGG + Intergenic
927591753 2:24362677-24362699 GCCTAACAGGAATAAAAAATAGG - Intergenic
928191361 2:29172561-29172583 GCCAAACAAAAAGGATAAACAGG - Intronic
929404248 2:41623326-41623348 GCTTAACAGAAATCATCAAAAGG + Intergenic
931181051 2:59901101-59901123 GCCTAACAAAAAACATAATTAGG - Intergenic
933352812 2:81177480-81177502 GACTAGAAGAAATCTTAAACTGG + Intergenic
934057215 2:88261490-88261512 GCCTAATTGAAGACATAAACTGG - Intergenic
936554617 2:113484173-113484195 AACTAACAGAAAACATACACAGG - Intronic
936741512 2:115516876-115516898 GCTTAACATAATTCACAAACAGG + Intronic
939825554 2:147011232-147011254 GCCTTAAAGAAATCAGAAAAAGG + Intergenic
940708328 2:157131695-157131717 GCTTTACAGAAAACATTAACGGG + Intergenic
943075898 2:183194233-183194255 TCCTAATAGAACTCATAAAATGG - Intergenic
943784513 2:191862298-191862320 CCCTAACAGAATTCACAAATGGG - Intergenic
943807358 2:192138549-192138571 GCATTACACAAATCATAAAGTGG + Intronic
1169041582 20:2499770-2499792 CATTAACAGAAATCATCAACAGG + Intronic
1169479450 20:5965129-5965151 GTCTAACAAAAACAATAAACAGG + Intronic
1170146627 20:13182105-13182127 TCCTAACAGAAGTCACAAAGAGG - Intergenic
1172028149 20:31963441-31963463 TCCAAAAAGAAATCATAAATTGG + Intergenic
1172593104 20:36131408-36131430 ACCTAAGAGAAATAAAAAACAGG - Intronic
1176701080 21:10050716-10050738 GCCTAGCAGAAATCAATAAATGG + Intergenic
1177712863 21:24802922-24802944 GCCTAAAAGAAAAAATAAAAGGG - Intergenic
1184487595 22:44790292-44790314 GCCTAGCTGAAACCAAAAACTGG + Intronic
950487036 3:13279966-13279988 GCCCAAAAGAAATGACAAACAGG + Intergenic
956762378 3:72455449-72455471 GCACAACAGGAAGCATAAACAGG + Intergenic
958196059 3:90244135-90244157 GCCTAACACTAATTATAAAAGGG - Intergenic
958419255 3:93912778-93912800 GCCTAACACCAATTATAAAAGGG - Intronic
960196168 3:114771061-114771083 GCGTAACAGAAGTCATATATGGG - Intronic
963236118 3:142958541-142958563 GACTAACAGCAATAATAAACAGG - Intronic
966053560 3:175652945-175652967 GCCTTACTGATAACATAAACAGG + Intronic
967683353 3:192391523-192391545 GCCTCACAGAAATTCTAATCTGG + Intronic
971152521 4:24048739-24048761 GCTTGACAGAAATTATAAAAAGG - Intergenic
972697441 4:41461658-41461680 ACCTAACAGAAATCAGGCACTGG - Intronic
972803709 4:42505987-42506009 CCCTAACAGAGATCTTACACAGG - Intronic
975654179 4:76624672-76624694 GCCAAACAGAAATTATAAAGAGG + Intronic
976174953 4:82342355-82342377 GTCCAACAAATATCATAAACAGG + Intergenic
979801417 4:124913845-124913867 TCCTGGCAGAACTCATAAACAGG + Intergenic
980373232 4:131907042-131907064 GCCTAGCAGAAATCAATAAGTGG + Intergenic
980850229 4:138372830-138372852 GCCTAACAGATATCATGCAATGG + Intergenic
980938073 4:139245237-139245259 GACTGACAGAAATTATAACCAGG + Intergenic
981136840 4:141220475-141220497 GCATAACAGAAATAAGAGACAGG + Intergenic
982626436 4:157772690-157772712 GCTTGACATAAACCATAAACTGG + Intergenic
984873405 4:184346951-184346973 GCCAAACAGAACTCAGAAATGGG + Intergenic
987559758 5:19504887-19504909 TGATAACAGAAACCATAAACTGG - Intronic
988998876 5:36740821-36740843 GCCTAACAAATACCATAGACTGG + Intergenic
989954533 5:50342005-50342027 GCTTAAATGAAGTCATAAACTGG - Intergenic
989985469 5:50691712-50691734 GCCTACTAGACATCACAAACTGG + Intronic
990962285 5:61407010-61407032 GCCTCTCAGAAATCTTAAAAAGG + Intronic
992769274 5:80032292-80032314 GCCTAACAGAATTTACAATCTGG - Intronic
994436000 5:99734674-99734696 GCCTAACAGAAAACATGACTGGG + Intergenic
995044192 5:107625594-107625616 GCATAACAGCAAGCAGAAACAGG + Intronic
996523425 5:124451880-124451902 GCCTGTTAGAAAGCATAAACTGG - Intergenic
996591515 5:125153130-125153152 GCCTAAGAGAGATCTTAAACTGG - Intergenic
1001473840 5:172035322-172035344 GGCAAACAGAAACCATAAAAGGG + Intergenic
1005254353 6:23984123-23984145 CCCAAGCAGACATCATAAACTGG + Intergenic
1005850467 6:29817039-29817061 GCCCAACAGCATTCATCAACAGG + Intergenic
1008509700 6:52264693-52264715 GCCTCACAGAATCCATCAACCGG - Exonic
1009810252 6:68653223-68653245 GCCTCACAGTCATCATAGACAGG - Intronic
1011051165 6:83151562-83151584 GCCAAAGAGAAAACAGAAACGGG - Intronic
1012008785 6:93753647-93753669 GCCTAACTGAAGTCAGAAACAGG + Intergenic
1012906462 6:105072390-105072412 TAATAACAGAAATAATAAACAGG - Intronic
1013782132 6:113740643-113740665 GGTGAACAGAAATCATAAAGGGG - Intergenic
1015262354 6:131252601-131252623 GCCTAACAGTACTTATAAAGGGG + Intronic
1015424923 6:133054487-133054509 TCTTAACAGAAATGCTAAACAGG - Intergenic
1020285137 7:6672863-6672885 GCCCAACAGAAATCATAAGCAGG - Intergenic
1021469351 7:20983609-20983631 CCCTAACATAAATCTTCAACTGG - Intergenic
1028857027 7:95604132-95604154 GCATCACAGAAACCATATACAGG + Intergenic
1029868695 7:103664169-103664191 CTATAACAGAAGTCATAAACTGG + Intronic
1034085263 7:148316589-148316611 TTCTAATAGAAATCATTAACTGG + Intronic
1036600045 8:10252389-10252411 GCCTAACAGAAATCATAAACAGG - Intronic
1039835671 8:41254478-41254500 TCCTAAAAGAAATGATAAATAGG + Intergenic
1040746140 8:50644565-50644587 GCCTAACTGAAAATATAAGCAGG - Intronic
1043653601 8:82632528-82632550 CGTTAACAGAAATCATAAATCGG + Intergenic
1043826467 8:84935379-84935401 GACAAACAGAAATCATTAAAAGG - Intergenic
1043842719 8:85127628-85127650 GCCTAAAAGAAATCGGGAACTGG - Intronic
1043928560 8:86065191-86065213 GCCTTTGAGAAATTATAAACAGG - Intronic
1045332432 8:101166975-101166997 GTTTAACAGAAATCAAAATCAGG + Intergenic
1045405641 8:101864114-101864136 GCTTAATTGAAATCATACACAGG - Intronic
1045993487 8:108337318-108337340 ACCTAACAGAAAGTATAAGCAGG + Intronic
1049898395 9:133012-133034 AACTAACAGAAAACATACACAGG + Intronic
1050068528 9:1786348-1786370 GTCTAAAACAAATAATAAACTGG - Intergenic
1052254482 9:26438308-26438330 TCCAAACCTAAATCATAAACAGG + Intergenic
1052806382 9:33017558-33017580 TCCTATCAGAATTCATAAATTGG - Intronic
1052840266 9:33287230-33287252 GCCCCACTGAAATCAGAAACAGG - Intergenic
1053638224 9:40037215-40037237 GCCTAGCAGAAATCAATAAATGG + Intergenic
1053741459 9:41143314-41143336 AACTAACAGAAAACATACACAGG + Intronic
1053767861 9:41428005-41428027 GCCTAGCAGAAATCAATAAATGG - Intergenic
1054319015 9:63633818-63633840 GCCTAGCAGAAATCAATAAATGG + Intergenic
1054346671 9:63972800-63972822 AACTAACAGAAAACATACACAGG + Intergenic
1054444448 9:65299457-65299479 AACTAACAGAAAACATACACAGG + Intergenic
1054485824 9:65722041-65722063 AACTAACAGAAAACATACACAGG - Intronic
1054546526 9:66339509-66339531 GCCTAGCAGAAATCAATAAATGG - Intergenic
1054686889 9:68287987-68288009 AACTAACAGAAAACATACACAGG - Intronic
1058918990 9:109595350-109595372 GCATAGCAGATATCATAGACTGG - Intergenic
1059553026 9:115249726-115249748 GCCTAAAAGAAAACATGAAGGGG - Intronic
1202786094 9_KI270719v1_random:20773-20795 GCCTAGCAGAAATCAATAAATGG + Intergenic
1185540091 X:896408-896430 CCATAACAAAAATCATAGACTGG - Intergenic
1187666959 X:21624299-21624321 TAATAACAGCAATCATAAACTGG + Intronic
1188649033 X:32607565-32607587 TCATAACAGAAATATTAAACAGG + Intronic
1188749773 X:33890475-33890497 TCCTTAAGGAAATCATAAACTGG - Intergenic
1188985300 X:36763647-36763669 GCCTAACAGGAAGCATGAATGGG + Intergenic
1196194444 X:112825071-112825093 GCCTAAAAGAAAGCAGAAATAGG - Intronic
1196895908 X:120335266-120335288 GCCTACAAGAAATCCTAAAGTGG - Intergenic
1200732509 Y:6758062-6758084 GGCTAACAGACATCTCAAACAGG - Intergenic
1202602619 Y:26609821-26609843 GCCTAAAACAAAGCATACACAGG - Intergenic