ID: 1036600049

View in Genome Browser
Species Human (GRCh38)
Location 8:10252420-10252442
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036600045_1036600049 8 Left 1036600045 8:10252389-10252411 CCTGTTTATGATTTCTGTTAGGC 0: 1
1: 0
2: 2
3: 7
4: 151
Right 1036600049 8:10252420-10252442 TTCACCAGTATTGAGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr