ID: 1036604844

View in Genome Browser
Species Human (GRCh38)
Location 8:10295692-10295714
Sequence GGTGCCAAGTGACCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036604844_1036604854 18 Left 1036604844 8:10295692-10295714 CCAGCCTGTGGTCACTTGGCACC 0: 1
1: 0
2: 0
3: 24
4: 191
Right 1036604854 8:10295733-10295755 GTACTCTGGATCTGCAGCCCAGG No data
1036604844_1036604853 4 Left 1036604844 8:10295692-10295714 CCAGCCTGTGGTCACTTGGCACC 0: 1
1: 0
2: 0
3: 24
4: 191
Right 1036604853 8:10295719-10295741 GGAGAGGTGGACTTGTACTCTGG No data
1036604844_1036604855 27 Left 1036604844 8:10295692-10295714 CCAGCCTGTGGTCACTTGGCACC 0: 1
1: 0
2: 0
3: 24
4: 191
Right 1036604855 8:10295742-10295764 ATCTGCAGCCCAGGCAGCAGTGG No data
1036604844_1036604856 28 Left 1036604844 8:10295692-10295714 CCAGCCTGTGGTCACTTGGCACC 0: 1
1: 0
2: 0
3: 24
4: 191
Right 1036604856 8:10295743-10295765 TCTGCAGCCCAGGCAGCAGTGGG No data
1036604844_1036604848 -9 Left 1036604844 8:10295692-10295714 CCAGCCTGTGGTCACTTGGCACC 0: 1
1: 0
2: 0
3: 24
4: 191
Right 1036604848 8:10295706-10295728 CTTGGCACCCCCTGGAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036604844 Original CRISPR GGTGCCAAGTGACCACAGGC TGG (reversed) Intronic
900114667 1:1023401-1023423 GGGGACCACTGACCACAGGCTGG - Intronic
901008388 1:6183089-6183111 GGTGCCAGGTGGCCACAGCGTGG - Intronic
901296954 1:8168174-8168196 GGTGACCAGTCACCACAGGAAGG - Intergenic
901446839 1:9313672-9313694 GGGGTCGAGTGAGCACAGGCAGG + Intronic
901680647 1:10910766-10910788 GGTGCCAAGGGACACCAAGCAGG + Intergenic
902569867 1:17340446-17340468 GGTGCCATGTGAGCAGAGGGAGG + Intronic
903822013 1:26110791-26110813 GGTCCTAAGTGACCCCGGGCTGG + Intergenic
903975700 1:27148554-27148576 CATGCTAAGTGACCTCAGGCAGG + Intronic
906203503 1:43974891-43974913 GGTACCACGTGACCCCACGCCGG - Exonic
907885496 1:58589036-58589058 GGTGCCATATGAAGACAGGCGGG + Intergenic
907945435 1:59131969-59131991 GGTGCACAGTGACAACAGGTTGG + Intergenic
910209361 1:84777613-84777635 TGTGACATGTGAGCACAGGCTGG + Intergenic
911648537 1:100360950-100360972 TGTGCCAGGTCACCACAGGGCGG + Intronic
911846785 1:102763000-102763022 CATGTCAACTGACCACAGGCTGG + Intergenic
912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG + Intergenic
912690226 1:111799544-111799566 TGGGCCAAGTGACAACAGGAGGG - Intronic
913974759 1:143446362-143446384 GGAGTTATGTGACCACAGGCTGG + Intergenic
914069150 1:144271978-144272000 GGAGTTATGTGACCACAGGCTGG + Intergenic
914110005 1:144694376-144694398 GGAGTTATGTGACCACAGGCTGG - Intergenic
915895738 1:159809412-159809434 GGTGCAGAGTGAGCACAGGACGG - Exonic
915920549 1:159972808-159972830 GGTGCAGAGTGAGCACAGGATGG + Intergenic
917971643 1:180211726-180211748 GGTGGCATGTGAACCCAGGCAGG - Intergenic
918994528 1:191739678-191739700 GGAGTCAAGTGAGGACAGGCAGG - Intergenic
919984162 1:202661289-202661311 GGTGGCAAGTGATAACTGGCTGG - Intronic
923086035 1:230704138-230704160 GGTTCCAAGTGTGCACAGGGTGG - Intronic
924179141 1:241424038-241424060 GGTGGCAAGTGGCCAGAGTCCGG - Intergenic
924212089 1:241780270-241780292 GATGCAAAGTGACCAGTGGCTGG - Intronic
1064169367 10:13016670-13016692 AGAGCCAGGGGACCACAGGCAGG - Intronic
1065241460 10:23709148-23709170 AGTGTCAAGTGGCCGCAGGCTGG - Intronic
1065716375 10:28572970-28572992 TTTGACAAGTGACCACAGGTGGG + Intronic
1067704004 10:48593587-48593609 GCTACTAAGTGACCACAGGCAGG + Intronic
1069163056 10:65113484-65113506 GGAATCAAGTGTCCACAGGCTGG + Intergenic
1071301823 10:84261702-84261724 TGTGCCAAGGGCCCACAGGGAGG - Intergenic
1073542419 10:104324606-104324628 GGAGCCCAGTGGCCACAGGGTGG - Intronic
1075590202 10:123685507-123685529 GCTGCCACGTGGCCACTGGCGGG - Intronic
1076046656 10:127299674-127299696 CATGACAAGTGACCACAAGCTGG - Intronic
1076445364 10:130510347-130510369 GGTGCCCAGTGTCCACTGGTAGG + Intergenic
1076721073 10:132393531-132393553 GGTGCCCAGAGGCCAAAGGCAGG - Intergenic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1079854656 11:25586923-25586945 AATGCCAAATGACCACAGGATGG + Intergenic
1084088621 11:66866093-66866115 AGTGCCAAGTTGCCACAGCCCGG - Intronic
1084561281 11:69906682-69906704 ACTGCCCTGTGACCACAGGCAGG + Intergenic
1086411947 11:86552470-86552492 GGTGGCAAGTTACCAAAGGCAGG - Intronic
1087759077 11:102086490-102086512 GGTGACAAGTGACCACAGAATGG + Intergenic
1089327682 11:117668563-117668585 GCTGGCAAGTGAGCCCAGGCAGG + Intronic
1091220552 11:133927768-133927790 GCTGCCACGTCACCACAGGGAGG + Intronic
1091756611 12:3056520-3056542 TGGTCCCAGTGACCACAGGCTGG - Intergenic
1096880152 12:54660746-54660768 GCTACCAAGGGACAACAGGCAGG - Intergenic
1101436283 12:104667533-104667555 GGAGCCAAGTGGACACAGGATGG + Intronic
1103592965 12:122005350-122005372 GGGTCCAACTGACCACAGGTCGG - Intergenic
1103829530 12:123767859-123767881 TGTCACAAGTGACCACAGACTGG + Intronic
1105332890 13:19434331-19434353 GGTATCAAGTGTCCATAGGCTGG + Intronic
1105878806 13:24585450-24585472 GGTATCAAGTGTCCATAGGCTGG - Intergenic
1105921040 13:24963607-24963629 GGTATCAAGTGTCCATAGGCTGG + Intergenic
1106009431 13:25804735-25804757 GGTGCCGAGCTGCCACAGGCTGG + Intronic
1106138402 13:26991400-26991422 GGTGCCAGGAGACCCCAGGATGG - Intergenic
1113961825 13:114130555-114130577 GGGGCCGAGTGCCCGCAGGCCGG + Intronic
1114551489 14:23535066-23535088 GGTGGGAAGTGACCACAGTCAGG + Exonic
1115055904 14:29126062-29126084 GCTGCTAAGTGACCTCAGGTAGG - Intergenic
1117252492 14:53951260-53951282 GGGGCCAACAGAGCACAGGCAGG + Intronic
1120049275 14:79846138-79846160 GTTGCAAAGTGAGCACAGGCAGG + Intronic
1121031693 14:90663830-90663852 GATGCCAAGAGCCCACTGGCAGG - Intronic
1121338122 14:93089502-93089524 GATGCCAGATGCCCACAGGCAGG + Intronic
1122694052 14:103544329-103544351 GGCACCGAGCGACCACAGGCCGG + Intergenic
1122812911 14:104297836-104297858 GGAGCCCACTGAGCACAGGCAGG - Intergenic
1122893355 14:104743101-104743123 AGTGGGGAGTGACCACAGGCAGG + Exonic
1122920554 14:104878201-104878223 GGCCCCATGTGACCTCAGGCTGG - Intronic
1125524870 15:40368446-40368468 GGTCGCCAGTGTCCACAGGCAGG - Exonic
1128126012 15:65193489-65193511 GGTGCCAGGTAACCTCAGGAAGG - Intergenic
1128546660 15:68573118-68573140 GGAGCCACCTGAACACAGGCTGG - Intergenic
1129871724 15:78945473-78945495 GGTGCAAGGTGAAGACAGGCAGG - Intronic
1133575316 16:7083384-7083406 GGTGCAAACTGAGCAGAGGCAGG + Intronic
1133812123 16:9168763-9168785 GCTAGCAAGTGACCAGAGGCTGG + Intergenic
1138116456 16:54364355-54364377 GGTCCTGAGTGATCACAGGCCGG - Intergenic
1139261194 16:65595836-65595858 GGTGGGAAGAGACCAGAGGCAGG - Intergenic
1140521298 16:75584378-75584400 GGTGGCAAGTATCCACGGGCGGG - Intergenic
1141749010 16:85945958-85945980 GCTGCCAGGTGAGAACAGGCAGG + Intergenic
1142433107 16:90041028-90041050 TGGGCCCAGTGAGCACAGGCAGG + Intronic
1143569432 17:7745946-7745968 TTTGCCACGTGACCTCAGGCGGG + Intronic
1147720251 17:42535603-42535625 GGGGCCATGTGAGCCCAGGCCGG - Intergenic
1148697097 17:49567295-49567317 GGAGGCAGGTGACCTCAGGCCGG + Intergenic
1149815492 17:59719251-59719273 GGTCACAGGTCACCACAGGCTGG - Intronic
1151474914 17:74339845-74339867 GGTCCAAAGGGACCTCAGGCAGG + Intronic
1151903235 17:77031532-77031554 GCTGCCAAAGTACCACAGGCTGG - Intergenic
1152689938 17:81713367-81713389 GCTGCCCAGTGACCACAGCCAGG - Intronic
1153865166 18:9260968-9260990 GGTGGTAAGGGACCACAGGAGGG - Intronic
1153939650 18:9967325-9967347 GGTGTCATGTGACCGCAGGAGGG - Intergenic
1154411582 18:14144844-14144866 GGTGCCAGCTGCCCACACGCTGG + Intergenic
1160568020 18:79798748-79798770 CGTCCCCAGTGACCACAGTCCGG - Intergenic
1160985087 19:1834909-1834931 GGAGCCCAGTGACCACAGGGAGG - Intronic
1162818254 19:13208725-13208747 GGCTGCAAGTGACCCCAGGCTGG - Intronic
1165273920 19:34732623-34732645 TGTGCCAGGTAACCTCAGGCAGG + Intergenic
1166519430 19:43470462-43470484 GATGCCAAGTGACCTCACCCAGG - Intergenic
1166520100 19:43474580-43474602 GGTGCCAACTGAACTAAGGCTGG + Intergenic
1167513528 19:49909616-49909638 GGTGGCAAGTGAGAACAGGCCGG + Exonic
1168153929 19:54462991-54463013 GGTGCCGAGTGGACACTGGCGGG - Exonic
1168628069 19:57934627-57934649 GGAGCCAGGTGACCTCAGACTGG + Intronic
1168688761 19:58364158-58364180 GGTCCAAAGTGACCACTGCCAGG - Intergenic
926518865 2:13884172-13884194 GGTGACTAGAGACCACAGCCTGG - Intergenic
926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG + Intronic
929126748 2:38529406-38529428 GGTGCCAAGTGACCTCACGATGG + Intergenic
931226306 2:60334862-60334884 GCTGCCGGGTGTCCACAGGCAGG + Intergenic
934179458 2:89607330-89607352 GGAGCTATGTGACCACAGGCTGG + Intergenic
938690855 2:133787787-133787809 GGTGGGGACTGACCACAGGCTGG - Intergenic
938982327 2:136538614-136538636 TGTGCCACGTGGCCATAGGCTGG - Intergenic
940268829 2:151869520-151869542 GCTGCCAGGAGACAACAGGCTGG + Intronic
943767343 2:191677630-191677652 GGTACCAAGGGAAAACAGGCTGG - Intergenic
945696967 2:213119058-213119080 GGTTCCTAGTGTCCACAGACAGG + Intronic
947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG + Exonic
947586791 2:231361534-231361556 TGTGCCACGTGAGCACAGACTGG + Intronic
1168806488 20:675171-675193 GGTGGCAAGAGAACACAGACGGG - Intronic
1170896876 20:20422959-20422981 GATTCCAAGTTGCCACAGGCTGG - Intronic
1170906969 20:20524999-20525021 GGTGCCAACTCACCACAGAAAGG + Intronic
1171410528 20:24943962-24943984 TGTTCCAAGTGGCCCCAGGCAGG - Intergenic
1173646183 20:44634476-44634498 GGTGCCCAGTAAGCACAGGGCGG - Intronic
1174523968 20:51156644-51156666 GGTGACAAGTGACAAGATGCAGG + Intergenic
1176026963 20:62990704-62990726 GGTACTAAGTGCCCACAAGCCGG - Intergenic
1176088958 20:63310493-63310515 GGGGCCTGGTGACCACAGGTAGG + Exonic
1176740131 21:10594210-10594232 GGTATCAAGTGTCCATAGGCTGG - Intronic
1176861472 21:14013580-14013602 GGTGCCAGCTGCCCACACGCTGG - Intergenic
1179746266 21:43445651-43445673 GGGGCCAAGTGCCCACTGCCCGG + Intergenic
1179802008 21:43815470-43815492 CGTGACAAAGGACCACAGGCTGG + Intergenic
1182020681 22:27079097-27079119 GGCACCAAGTGCCCACAGGATGG - Intergenic
1182415320 22:30217704-30217726 GGAGGAAAGTGGCCACAGGCTGG - Intergenic
1183359363 22:37375574-37375596 GGTGCCTAGCGGCCAGAGGCTGG + Exonic
1183655398 22:39181571-39181593 GGTGCACAGTGAGCACAGGGAGG + Intergenic
950477466 3:13223119-13223141 GCTGCCATGTGCCCACTGGCCGG - Intergenic
950487034 3:13279948-13279970 TGGGCCAACTGAGCACAGGCAGG - Intergenic
950620966 3:14204946-14204968 GGGGGCAACTGACCAGAGGCAGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953353412 3:42233363-42233385 GCAGCAAACTGACCACAGGCAGG - Intergenic
953403895 3:42650870-42650892 GGTCCTAGGTGACCAGAGGCTGG - Intergenic
957243381 3:77687732-77687754 GGAGCCTAGTGGCCACAAGCTGG + Intergenic
961156510 3:124684259-124684281 GGTACCAAGTGGCCGCAGGATGG - Intronic
961358754 3:126354836-126354858 TCTGCCAGGTGACCTCAGGCAGG + Intronic
962986335 3:140539610-140539632 GGTGCCAAGAAACCCCAGGATGG - Intronic
965077759 3:164001695-164001717 GTTGCCAAGTGATCAGAAGCTGG - Intergenic
966329073 3:178790621-178790643 GGTGCACAGTGACCACTGCCTGG - Intronic
966642954 3:182210681-182210703 TGTGGCATGTGACAACAGGCTGG + Intergenic
966771543 3:183508310-183508332 GGTGCAGAGTGTCCACGGGCAGG + Exonic
969536885 4:7761817-7761839 GGTGGGAAGTGACCACTGGAGGG + Exonic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
969829824 4:9786287-9786309 GGAGCTCTGTGACCACAGGCTGG - Intronic
972450726 4:39195576-39195598 GATGCCAAGTGACCAGAGGTTGG - Intronic
972599597 4:40560526-40560548 ACTGGCAAGTGACCAAAGGCTGG - Intronic
977475283 4:97499712-97499734 GGTGGCAAATGAACAAAGGCTGG + Intronic
977918593 4:102620046-102620068 GGAGCCAAGTGGCCACATGGAGG + Intergenic
981012825 4:139943347-139943369 GGTCACAAGTGGCCAGAGGCTGG + Intronic
981517479 4:145625388-145625410 GGAGCCTAATGACCACTGGCAGG + Intronic
982116732 4:152104430-152104452 CGTGACAAAGGACCACAGGCTGG - Intergenic
983831171 4:172329836-172329858 GGTGGCTAGTGACCCCAGCCAGG + Intronic
986339465 5:6776766-6776788 GGTGGGAGGTGCCCACAGGCAGG + Intergenic
988972600 5:36484506-36484528 GATGCCAAGTGACCAGAGTCGGG - Intergenic
991481468 5:67085650-67085672 GTTGTCAAGTGTTCACAGGCAGG - Intronic
993068910 5:83134003-83134025 GGTTCCAGGTGAGCACGGGCTGG + Intronic
997505045 5:134410775-134410797 GGGGCCAAATGACCAGAGTCAGG + Intronic
997797082 5:136821017-136821039 GGGGCCATGTGAGCACAGTCAGG - Intergenic
1001446186 5:171785786-171785808 GATGCCTGGTGACCACAGGTGGG + Intergenic
1002472999 5:179448417-179448439 GGTGCCAGGTGACCTCACGCAGG - Intergenic
1002481225 5:179502237-179502259 GGTGCCAGGTGACCTCACGCAGG + Intergenic
1003030563 6:2597090-2597112 GGGGCTCAGTGACCAGAGGCAGG - Intergenic
1003307914 6:4946002-4946024 GCTGCCCAGCGCCCACAGGCGGG + Intronic
1005752585 6:28897019-28897041 GGCTCCAAGTGACCACTGCCAGG + Intergenic
1006433196 6:34010912-34010934 TGTGACAAATGACCACAGACTGG + Intergenic
1007176864 6:39903096-39903118 GGTTCCAAGTGGCCACCTGCAGG - Exonic
1010054623 6:71551057-71551079 GCTGCCAAGTGATCAGAAGCTGG - Intergenic
1014557516 6:122852206-122852228 GGTGCCAAGAGACCAAAGAATGG - Intergenic
1015233288 6:130940830-130940852 AGTGCCAAGTTACTATAGGCTGG - Intronic
1016182802 6:141168178-141168200 GGTTCCAAGTGAGCGCGGGCTGG + Intergenic
1016843071 6:148543954-148543976 GGGGCCAAGTGTCCACAGTCTGG - Exonic
1018180791 6:161221609-161221631 GCTGCCAAAGGACCACAGACTGG + Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019524012 7:1472699-1472721 GGTGCCGTGTCACCTCAGGCAGG + Intronic
1019688153 7:2393948-2393970 GTTGCCAAGTGAGCAGAAGCTGG - Intergenic
1020715686 7:11673147-11673169 GGTGCTCAGTGACTCCAGGCAGG - Intronic
1022249581 7:28593943-28593965 GGAGCCAAGTAACCACTGGTGGG + Intronic
1024347883 7:48331509-48331531 GGTGCCCACTGACCACAGTTGGG - Intronic
1026144138 7:67731179-67731201 GGTGCCAATGGACCCCAGCCTGG - Intergenic
1030679693 7:112422033-112422055 GGTGGAAAGTGACCACTGGCTGG + Intergenic
1031171687 7:118299672-118299694 TATTCTAAGTGACCACAGGCTGG + Intergenic
1032388902 7:131543018-131543040 GGTGCTCTGTGACCAGAGGCTGG + Intronic
1035232907 7:157477032-157477054 GGTTCCGGATGACCACAGGCTGG + Intergenic
1035232912 7:157477053-157477075 GGTTCCGGATGACCACAGGCTGG + Intergenic
1035321510 7:158032510-158032532 GATGCCAAGAGACCCAAGGCAGG + Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1036656692 8:10681606-10681628 GGTGCCAGGTGGCCACAGGTGGG - Intronic
1037817818 8:22121015-22121037 GGAGCCAGGGGACCAGAGGCTGG - Intronic
1039439960 8:37588282-37588304 TGTGACAAGAGACCACATGCTGG + Intergenic
1040000793 8:42575041-42575063 GGTGAGAAGTGACCACGTGCTGG + Intergenic
1040684478 8:49855744-49855766 TTTGCCAAGTGCCTACAGGCCGG + Intergenic
1040826336 8:51624232-51624254 GGAGCCAAAGGACCACAGACCGG + Intronic
1041965941 8:63676597-63676619 ATTGCCAAATGTCCACAGGCTGG + Intergenic
1042358433 8:67855023-67855045 GGTGCCAAGTAACAACAGGATGG - Intergenic
1042855899 8:73266993-73267015 GGTGCCAACTGACCAAAGATAGG + Intergenic
1047529307 8:125660706-125660728 GCTGCAAAGTGACCACAGTTTGG - Intergenic
1047554532 8:125914687-125914709 GGTGCCAAGTACCCACAGCTTGG + Intergenic
1048386809 8:133919695-133919717 GCTGCCAAGTGACTGCAGGCCGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1048949112 8:139478372-139478394 GAGGCCGAGTGACCAGAGGCAGG + Intergenic
1049254146 8:141605006-141605028 GGTGGCAGGTGAGCCCAGGCCGG + Intergenic
1049649699 8:143759940-143759962 CTTGCAAAGTGACCACAGGCAGG + Intergenic
1051867396 9:21696785-21696807 GGCGCCAAGTGGCCACCGGAGGG + Intergenic
1053242945 9:36511328-36511350 TTTGCTATGTGACCACAGGCAGG - Intergenic
1057295033 9:93829866-93829888 CGTGCTGAGTGACCACAGGCAGG - Intergenic
1058645988 9:107131788-107131810 CGGGCCAAGTGACCTCATGCAGG - Intergenic
1060692755 9:125678707-125678729 TGTTCCTAGTTACCACAGGCAGG - Intronic
1062173609 9:135148804-135148826 GGGGTCAGGTGACCACAGGGTGG + Intergenic
1062214083 9:135379704-135379726 GGTGACACAAGACCACAGGCTGG - Intergenic
1062282359 9:135757716-135757738 GGGGCCACGGGGCCACAGGCAGG + Intronic
1062357005 9:136169851-136169873 GGTGCCCAGTGTGCACAGCCAGG + Intergenic
1062648611 9:137564066-137564088 AGTCCCAGCTGACCACAGGCAGG + Intronic
1185681858 X:1895099-1895121 ATTGCTAAGTGACCAGAGGCTGG + Intergenic
1185822650 X:3219944-3219966 GGCAACAAATGACCACAGGCTGG + Intergenic
1195321919 X:103727662-103727684 GCAACCAAGTGAGCACAGGCAGG + Intronic
1197650495 X:129058539-129058561 GCTACTGAGTGACCACAGGCTGG + Intergenic
1199690967 X:150308788-150308810 GATGCTATGGGACCACAGGCTGG + Intergenic