ID: 1036609696

View in Genome Browser
Species Human (GRCh38)
Location 8:10339201-10339223
Sequence CTCCAACATCATCGCTTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036609696_1036609698 25 Left 1036609696 8:10339201-10339223 CCCACGAAGCGATGATGTTGGAG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1036609698 8:10339249-10339271 ACCATCTCTTTATCTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036609696 Original CRISPR CTCCAACATCATCGCTTCGT GGG (reversed) Intronic
901943261 1:12680144-12680166 CTCCAGCCTCATTGCTTCTTTGG - Intergenic
904397530 1:30232168-30232190 TTCCAACATCATTCCTTCCTTGG - Intergenic
906686048 1:47764187-47764209 CCCCAACTTTATAGCTTCGTGGG - Exonic
923993361 1:239464614-239464636 CACCAACATCACCTCTTCATGGG - Intronic
1064601610 10:16999278-16999300 CTCCAAAATTATGGCTTCTTTGG - Intronic
1074463514 10:113661164-113661186 CTCAGACATCATTGCTTCCTAGG - Intronic
1078269234 11:9779573-9779595 TTCCAACATCTTCACTTCATTGG + Exonic
1088565150 11:111164128-111164150 CTTCATCATCATCACTTCATTGG + Intergenic
1095502863 12:42859832-42859854 CTCCTACATTATCGCCTCTTGGG - Intergenic
1099018931 12:77379640-77379662 CTCCAACTTCATCTCTTGGAGGG + Intergenic
1109327862 13:60891217-60891239 CCCCAACATGATTGCTTTGTAGG - Intergenic
1112789061 13:102983541-102983563 CTCCAACATCATCAGCTCCTGGG - Intergenic
1118385487 14:65252425-65252447 ATCCAACTTCATGGCTTAGTGGG + Intergenic
1124268820 15:28262242-28262264 CTCCAACATCATAGTTTTGATGG + Intronic
1126866246 15:52940482-52940504 CTCACACATCATAGCTTCTTTGG - Intergenic
1139471316 16:67179509-67179531 CTCCACCATCATCACTGCCTGGG + Exonic
1145202536 17:20959462-20959484 CTCCATCCTCATCTCTTTGTAGG - Intergenic
1146830320 17:36063431-36063453 CTGAAACATCATCTCTTCCTGGG + Intergenic
933995650 2:87667553-87667575 CTGCAACATCAGCTCTTCCTGGG - Intergenic
936298207 2:111283359-111283381 CTGCAACATCAGCTCTTCCTGGG + Intergenic
942693649 2:178614256-178614278 ATCCACCATCATCGCGTGGTGGG + Exonic
942702559 2:178730126-178730148 TGCCAACATCATTGCTTAGTTGG + Exonic
944047360 2:195428411-195428433 CTACAACATCAGCTCTTCCTTGG + Intergenic
1169869637 20:10237100-10237122 CTCCCCCATCAGCGCTTCCTAGG - Intronic
1174108670 20:48182239-48182261 TTCCAACATCAGCTCTTCCTTGG + Intergenic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
953039329 3:39240972-39240994 CTACAACATCAACTCTTCCTTGG + Intergenic
956318663 3:67969523-67969545 TTCCAAAATCATCGCTTGGTTGG + Intergenic
956567328 3:70653400-70653422 CACCATCGTCATTGCTTCGTGGG + Intergenic
957695244 3:83628710-83628732 CTGCAACATCAACTCTTCCTGGG - Intergenic
971364599 4:25967702-25967724 CTCCACCATTATGGCTTCATTGG - Intergenic
971364811 4:25969153-25969175 CTCCACCATTATGGCTTCATTGG - Intergenic
973714635 4:53663524-53663546 CTCCAACATCAGCTCTTCCCTGG - Intronic
974274995 4:59707829-59707851 CTGCAACATCACTGCTTCCTGGG + Intergenic
986440448 5:7776832-7776854 CTCCAACATCAAAGGTTCTTTGG + Intronic
988919107 5:35924507-35924529 TGCCAACATCATCGCTGGGTAGG - Intronic
990279427 5:54233773-54233795 TTCCAACTTCATAGCTGCGTGGG + Intronic
992784772 5:80159153-80159175 CTCCCACATCATCACATCCTTGG + Intronic
1003794999 6:9591226-9591248 ATCCAACATCATCACTCCTTAGG - Intergenic
1004081975 6:12403969-12403991 TTCCAACATCATCTCTTTGTTGG - Intergenic
1007122977 6:39399055-39399077 CTGCAACATCAACTCTTCTTTGG + Intronic
1008766251 6:54919007-54919029 CTCCAACATCTTGGCTTTGAGGG + Intronic
1012154118 6:95794964-95794986 CTGCAACATCAGTGCTTCCTTGG - Intergenic
1017791572 6:157804543-157804565 CTCCAACAACATCTCTTCCCTGG - Intronic
1018169147 6:161130474-161130496 CTCAAAGATCATCCCTTAGTGGG + Exonic
1022810979 7:33868790-33868812 CTCAAACATCATCTCTTCATCGG - Intergenic
1036609696 8:10339201-10339223 CTCCAACATCATCGCTTCGTGGG - Intronic
1044853849 8:96454560-96454582 CTGCAACATCAACTCTTCCTTGG - Intergenic
1049601935 8:143512003-143512025 AGTCAACATCATCCCTTCGTGGG - Intronic
1050039153 9:1470620-1470642 CTGCAACATCAGCTCTTCCTTGG + Intergenic
1050860063 9:10417170-10417192 CTTCAATATCATCCCTTCCTAGG - Intronic
1052893897 9:33729775-33729797 CTGCAACATCAGCTCTTCCTTGG + Intergenic
1057391298 9:94643405-94643427 CTCCAACATAACCCCATCGTGGG - Intergenic
1197700224 X:129594181-129594203 CACCACCATCATCCCTTCTTAGG + Intergenic