ID: 1036612223

View in Genome Browser
Species Human (GRCh38)
Location 8:10360252-10360274
Sequence ATAGGGCATCTGGTGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036612223 Original CRISPR ATAGGGCATCTGGTGGACCT GGG (reversed) Intronic
901147145 1:7072910-7072932 ATAGGTCATTGGGAGGACCTTGG + Intronic
901189920 1:7403674-7403696 ATAGGGCTGGTGGTGGTCCTCGG - Intronic
902162814 1:14545412-14545434 AGCGGGCATGTGGTGGAGCTAGG - Intergenic
902857938 1:19222697-19222719 ATAGGACTGCTGGAGGACCTGGG + Exonic
903318737 1:22528929-22528951 AGAGGGCATCTGATGGGCCCCGG - Exonic
903677122 1:25071407-25071429 CTTGGGCATCTGATGGGCCTGGG - Intergenic
903868538 1:26415552-26415574 AAGGGGCATCTTGAGGACCTTGG + Intronic
904458707 1:30662860-30662882 ATGGGGAATCTGGTGGATCAGGG - Intergenic
905522712 1:38612820-38612842 ATAGGTCAACAGGTTGACCTAGG + Intergenic
906184784 1:43853584-43853606 ACCAGGCATCTGGTAGACCTCGG - Intronic
907829728 1:58053321-58053343 ATTGGGCATCTGGTGGTCTCAGG + Intronic
909117628 1:71558756-71558778 CTAGAGCATCTGGTGGTGCTAGG - Intronic
909131103 1:71738419-71738441 TTTGGGCAACTGGTGGACCTAGG + Intronic
910838316 1:91537406-91537428 AGAGGGCATGAGGTGCACCTTGG + Intergenic
912278993 1:108293273-108293295 ATATGGTATCAGTTGGACCTAGG - Intergenic
912289233 1:108401084-108401106 ATATGGTATCAGTTGGACCTAGG + Intronic
912706672 1:111920063-111920085 CTAGGGCATCAGGTGGTCATTGG - Intronic
915845585 1:159260658-159260680 ATAGGGCACCTGGGTGCCCTGGG - Intergenic
915908636 1:159898642-159898664 ATAGGGCATAAGTTGCACCTGGG - Intronic
917767850 1:178243304-178243326 ATAGGCCATCTGGTGCCTCTAGG + Intronic
918152514 1:181810074-181810096 ATAAGGCATTAGGTAGACCTGGG + Intergenic
918551869 1:185752018-185752040 ACAGGGAGTCTGGTGCACCTTGG + Intronic
924212259 1:241782609-241782631 TTAGGGCCTCTCGTGGGCCTCGG - Intronic
1067061851 10:43081752-43081774 AGAGGGGCTCTGGTGGGCCTGGG - Intronic
1069532467 10:69229478-69229500 ACAGGGCATCTGGGGCCCCTGGG + Intronic
1070596095 10:77834222-77834244 AGAGGGAATGTGGAGGACCTGGG + Intronic
1076391713 10:130108259-130108281 ACGGAGCATGTGGTGGACCTGGG - Intergenic
1076891393 10:133285611-133285633 ATGGGGCATCAGGTCGATCTTGG + Exonic
1078339620 11:10489422-10489444 AGAGGGCAGCTGGTAGACCCAGG - Intronic
1081349542 11:42033238-42033260 TAAGGGCATCTAGTGGTCCTTGG + Intergenic
1085315214 11:75540568-75540590 ACAGGGCATCCTGTGTACCTTGG - Intergenic
1088469543 11:110178020-110178042 GGAGGGCAGATGGTGGACCTGGG - Intronic
1092144107 12:6202714-6202736 ATAGGTCATCAGCTGCACCTAGG - Intronic
1095792742 12:46185376-46185398 ATAGGGCTTGTGGTGGACACAGG - Intronic
1097570875 12:61329746-61329768 AAAGGGCATCTGGTAGAGCTGGG - Intergenic
1103951710 12:124554953-124554975 ATTGGGCACGTGGTGGACCCAGG + Intronic
1106431873 13:29688317-29688339 ACAGTGCATCTGGAGGAGCTGGG + Intergenic
1108385147 13:49892807-49892829 ATGGAGCACGTGGTGGACCTGGG - Intergenic
1108590473 13:51908389-51908411 ATGGAGCACGTGGTGGACCTGGG + Intergenic
1110414582 13:75238110-75238132 ATGGAACATGTGGTGGACCTGGG + Intergenic
1114204250 14:20553752-20553774 ATAGGGAATCTGGTGGATAGGGG + Intergenic
1116010770 14:39348949-39348971 ATGGAGCAGGTGGTGGACCTGGG - Exonic
1119017609 14:71075487-71075509 TAAGGCCATCTGGTGGTCCTAGG - Intronic
1121588088 14:95077694-95077716 ATTGGGCATGAAGTGGACCTAGG - Intergenic
1122408054 14:101512101-101512123 GTGGGGCATGGGGTGGACCTGGG - Intergenic
1122597951 14:102906658-102906680 ATAGGGCATCCGTTGAACTTTGG + Exonic
1122694063 14:103544365-103544387 ATAGGGCCTCTGGAGCTCCTGGG - Intergenic
1122694076 14:103544397-103544419 ATAGGGCCTCTGGGGCTCCTGGG - Intergenic
1125616214 15:41016060-41016082 AGAGGGAATCTTGGGGACCTAGG - Intronic
1132121731 15:99181739-99181761 CTGGGGCAGCTGGTGAACCTTGG + Intronic
1137934225 16:52618324-52618346 ATAGGTCATCTGGAGAACCAGGG - Intergenic
1138655712 16:58490192-58490214 ATAGGGCAGATGGTGGCCCTTGG + Intronic
1143514735 17:7414037-7414059 TTAGGGCATCTGCTGGATCCAGG - Intronic
1144285540 17:13770507-13770529 TTAGGGCATCTGGTGGAAGTAGG - Intergenic
1147944679 17:44074225-44074247 AGAGGGGAACTGGTGAACCTGGG - Exonic
1150343509 17:64387227-64387249 ATTTGGCATCAGGTGGTCCTTGG + Intronic
1152176783 17:78793106-78793128 ATAGGGCAGCAGGAGCACCTGGG - Intronic
1152565979 17:81100652-81100674 CTATGGCAGCTGCTGGACCTGGG - Intronic
1155045497 18:22099745-22099767 ATAGAGCATCTACTGGAACTGGG + Intergenic
1155081573 18:22415663-22415685 ATGGAGCACGTGGTGGACCTGGG + Exonic
1159104010 18:63985163-63985185 ATAGGGCAGCTCCAGGACCTGGG - Exonic
1159650795 18:70975061-70975083 ATAGGCCATGTGGAGGACTTTGG + Intergenic
1161431155 19:4233178-4233200 ATGGTGCAGCTGGTGGACGTTGG - Exonic
926804065 2:16688398-16688420 TTAGGGCCACTGGTGGGCCTGGG + Intergenic
927010157 2:18895794-18895816 ATTGGACAGCTGGTGGCCCTGGG - Intergenic
927494572 2:23543921-23543943 AGAGTCCACCTGGTGGACCTGGG - Intronic
931463326 2:62466682-62466704 ATAGACCAACTGGAGGACCTGGG + Intergenic
935527798 2:104192993-104193015 ATAGGGCTTCTGATAGAGCTGGG - Intergenic
941615468 2:167713826-167713848 ATGGAGCATGTGGTGGACCTGGG + Intergenic
941840301 2:170075692-170075714 AAAGAGAATCTGGTTGACCTAGG - Intronic
942412979 2:175730897-175730919 ATAGAGCTTCTGATGTACCTTGG - Intergenic
943204695 2:184878506-184878528 ATAAGCCATCTCCTGGACCTCGG + Intronic
945116200 2:206410350-206410372 CTCGGGCCTCTGGTGGACCCTGG - Intergenic
946410503 2:219513056-219513078 GTTGGGCAGCGGGTGGACCTCGG + Intergenic
946773561 2:223114035-223114057 GTAGAGCCTGTGGTGGACCTGGG + Intronic
1168793717 20:597162-597184 ATGGGGCACCTGCAGGACCTGGG - Intergenic
1169640769 20:7748842-7748864 AAAGGGCATGTGTTGGACATTGG + Intergenic
1171014069 20:21523798-21523820 ATATGGAATCCGGTGGCCCTGGG + Intergenic
1172620964 20:36318375-36318397 ATCCGGCAGCTGGTGGACCCAGG + Intronic
1174089895 20:48038478-48038500 GTCGGGCATCTGGGGGACCCAGG + Intergenic
1174822988 20:53743664-53743686 ATGAGGCACCTGGTGTACCTGGG - Intergenic
1175171338 20:57083696-57083718 ATGGGGCAGCTGGTGGAACTTGG - Intergenic
1175192706 20:57222307-57222329 TGAGGCCATCTGGTGGGCCTTGG - Intronic
1179309049 21:40180837-40180859 CCAAGGCATATGGTGGACCTGGG + Intronic
950659096 3:14455624-14455646 ATAGTGCACCTGGTGGGCCTGGG + Intronic
953520747 3:43640336-43640358 AGAAGGCATCTGGTGGATATTGG + Intronic
959402641 3:105921836-105921858 ATAGGGCATATAGAAGACCTGGG + Intergenic
961662814 3:128479284-128479306 ATGGGGCCTCTGTTGGGCCTGGG - Intergenic
965191796 3:165540076-165540098 AGAAGGCATCTGGTGCAGCTTGG - Intergenic
974011142 4:56608543-56608565 ACAGGGCATCTGTGGGACCTTGG + Intergenic
978326199 4:107559673-107559695 AAAGGGCCTGTGGTGAACCTGGG - Intergenic
981767977 4:148273900-148273922 ATAAGGCAGCTGGTGCAGCTGGG + Intronic
985937043 5:3105584-3105606 ATAAGGCACCTGGTGTACATAGG + Intergenic
986285962 5:6359213-6359235 AGAGGGCATCTGGTCTGCCTGGG + Intergenic
986958143 5:13181056-13181078 ACAGGGCCTCTGCTGGCCCTTGG + Intergenic
992641581 5:78772689-78772711 ATAGGGCATCTGGTTTTCCTTGG - Intergenic
994954359 5:106509020-106509042 ATAGGCCATCTGGTGTGACTTGG - Intergenic
995786852 5:115840182-115840204 ATAGTGCATCAGGTGGAAATGGG + Intronic
1002359922 5:178662347-178662369 ATAGAGCATCACGTGGACCAGGG - Intergenic
1006021714 6:31121348-31121370 ATAGCCCATCTGCTGGCCCTGGG + Intronic
1007896280 6:45362859-45362881 TTAGTGCATTTGATGGACCTTGG - Intronic
1013744135 6:113324739-113324761 AAAGGGAAACTTGTGGACCTAGG + Intergenic
1015305959 6:131708770-131708792 ATGGAGCATGTGGTGGACCTGGG + Exonic
1018938079 6:168287077-168287099 ACGGAGCATGTGGTGGACCTGGG + Intergenic
1019969469 7:4528596-4528618 ATAGGGCATATTGTGAACCACGG - Intergenic
1028151257 7:87375661-87375683 ATAGTGAACCTGATGGACCTGGG + Exonic
1028151757 7:87381665-87381687 GTAGGGCTTCTGGTGGGGCTTGG - Intronic
1031117050 7:117680102-117680124 GTGGGGCATTTGGTGGAGCTGGG + Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1033679018 7:143574043-143574065 ATGGAGCATGTGGTGGACCTGGG - Exonic
1033692820 7:143755411-143755433 ATGGAGCATGTGGTGGACCTGGG + Exonic
1033731591 7:144185729-144185751 ATGGAGCATGTGGTGGACCTGGG - Exonic
1033740074 7:144267003-144267025 ATGGAGCATGTGGTGGACCTGGG + Exonic
1036612223 8:10360252-10360274 ATAGGGCATCTGGTGGACCTGGG - Intronic
1037561395 8:20077967-20077989 ATAGTCCATCTGGTGAAACTTGG + Intergenic
1043104470 8:76090288-76090310 ATAAGGCATCTGGTGGAATTTGG - Intergenic
1044328392 8:90887737-90887759 AGAGGGCCTCTGATGGAACTAGG - Intronic
1048406815 8:134131377-134131399 ATTGGGCTTCATGTGGACCTGGG - Intergenic
1048425440 8:134319146-134319168 ACAGGGCACCTGGTAGACCCTGG - Intergenic
1051663449 9:19446317-19446339 CTCGGGCCTCTGGTGGACCCTGG + Exonic
1052365555 9:27608555-27608577 ATGGAGCATGTGGTGGATCTGGG + Intergenic
1053623540 9:39844892-39844914 ATAGAGCATCAGGTCGACTTAGG + Intergenic
1053881329 9:42598336-42598358 ATAGAGCATCAGGTCGACTTAGG - Intergenic
1054220360 9:62405807-62405829 ATAGAGCATCAGGTCGACTTAGG - Intergenic
1054230355 9:62503365-62503387 ATAGAGCATCAGGTCGACTTAGG + Intergenic
1054852134 9:69858066-69858088 AAAGGGCATTTTGTTGACCTTGG - Intronic
1058015754 9:100030490-100030512 CAAGGACATCTGGTGGAACTTGG + Intronic
1061867350 9:133499658-133499680 GTAGGGCATCTCGTGGAGCTGGG - Intergenic
1190220732 X:48510996-48511018 AAAGGGCATTTGGGGGACCTTGG - Intronic
1194574525 X:95595747-95595769 ATAGATCATCTGGTAAACCTGGG + Intergenic
1197746384 X:129934276-129934298 ATCGGGCTTCAGGTCGACCTTGG - Intergenic