ID: 1036613498

View in Genome Browser
Species Human (GRCh38)
Location 8:10370648-10370670
Sequence AGAGCAAAGTGGTTGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036613498_1036613508 24 Left 1036613498 8:10370648-10370670 CCTCGGGCCAACCACTTTGCTCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1036613508 8:10370695-10370717 CGTTACATACCTGGAATATCAGG No data
1036613498_1036613501 -2 Left 1036613498 8:10370648-10370670 CCTCGGGCCAACCACTTTGCTCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1036613501 8:10370669-10370691 CTCCTGTACTTGCCACCTCCAGG No data
1036613498_1036613505 15 Left 1036613498 8:10370648-10370670 CCTCGGGCCAACCACTTTGCTCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1036613505 8:10370686-10370708 TCCAGGCCACGTTACATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036613498 Original CRISPR AGAGCAAAGTGGTTGGCCCG AGG (reversed) Intronic
901324895 1:8360294-8360316 AGAGCAGGGTGGCTGGGCCGAGG + Exonic
904005847 1:27362824-27362846 AGAGCACAGTGAGTGGCCGGTGG - Intronic
906606598 1:47176855-47176877 AGAGAAAAGTGATTTGCCCAAGG - Intergenic
907222378 1:52916445-52916467 AGGGTAAAGTGGTTTGCCCAAGG - Intronic
913179830 1:116310945-116310967 AGAGCAAAGTGATGGGGCCAAGG - Intergenic
913287570 1:117240929-117240951 AGATCACAGTGGTTGGGCCATGG - Intergenic
913563396 1:120046379-120046401 AGTGCGAAGTGATTGGCCCTTGG - Intronic
913575771 1:120173095-120173117 AGAGGAAAGTGGTTGGTTCTTGG - Intronic
914283990 1:146205743-146205765 AGTGCGAAGTGATTGGCCCTTGG - Intronic
914384638 1:147156471-147156493 AGAGCAAAGTGAGTGGGCCTGGG + Exonic
914545021 1:148656482-148656504 AGTGCGAAGTGATTGGCCCTTGG - Intronic
914558085 1:148788666-148788688 AGAGGAAAGTGGTTGGTTCTTGG - Intergenic
914614749 1:149341564-149341586 AGAGGAAAGTGGTTGGTTCTTGG + Intergenic
914621546 1:149414206-149414228 AGTGCGAAGTGATTGGCCCTTGG + Intergenic
921591792 1:217012661-217012683 AGGGCAAAGTGGGAGGCCAGTGG - Intronic
923750657 1:236743373-236743395 AGAGGCTAGTGGTTGGCCCAGGG - Intronic
1064190755 10:13203545-13203567 AGAGCAGAGTGGTGAGCCCAAGG - Intronic
1065173977 10:23059664-23059686 GGAGCAAAGTGATTTGCCCCAGG + Intergenic
1067766615 10:49091944-49091966 AGAGGAAAGTGGTGGGGCCCTGG + Intronic
1070722116 10:78764148-78764170 AGAGCCAGGTGCTTGGCCTGGGG - Intergenic
1074696411 10:116053679-116053701 AGGGCAATGTGGTGGGGCCGTGG + Intergenic
1075640715 10:124062446-124062468 AGTGCAAAGCAGTTTGCCCGAGG - Intronic
1077547718 11:3182850-3182872 AGAGAAAAGAGGTTGGCTCATGG + Intergenic
1081858931 11:46320912-46320934 AGAACAGAGTGGTCGGCCCAAGG - Exonic
1083750836 11:64759732-64759754 AGAGCAAAGTAGTAGTCTCGTGG + Exonic
1085475007 11:76783927-76783949 GGAGCCAAGTCGTGGGCCCGAGG - Intronic
1085764795 11:79273498-79273520 TAAGGAAAGTGGTTGGCCTGTGG - Intronic
1087014508 11:93542890-93542912 AGTGCAAAGGGCTTGGGCCGGGG - Intronic
1087188190 11:95224933-95224955 ATAGCAAACTGGTTGGCTCAAGG - Intronic
1088932433 11:114365871-114365893 ATAGCAGTGTGGTTGGCCAGGGG - Intergenic
1090445404 11:126760757-126760779 AGAGAGAAGTGGTTTGCCCAAGG - Intronic
1093677209 12:21957215-21957237 AGAGCATAGTGGTCGGCCATTGG + Intergenic
1094840541 12:34341007-34341029 AGAGCAAGGTTATTGGCCCCTGG + Intergenic
1095511473 12:42955470-42955492 AAAGCAAAGTAGATGGCCCTTGG - Intergenic
1096564406 12:52465980-52466002 AGAGCAAAGTTGCCGGCACGAGG - Intergenic
1096840226 12:54375402-54375424 AGAGCGAAGTGGGTGGGCCAAGG + Intronic
1099920410 12:88950560-88950582 AGGGCAAAGTGGATTGCCCAAGG + Intergenic
1102059346 12:109920996-109921018 AGAGCAAAGTGGATGGCCAAAGG - Intronic
1102500910 12:113351877-113351899 AAAGGAAAGTGATTGGCCAGGGG - Intronic
1103209029 12:119153681-119153703 AGAGCAAAGGGGTGGGGCCTAGG - Intronic
1108443959 13:50487261-50487283 AGAGCTAAATGGTTTGCCCAAGG + Intronic
1108483128 13:50895554-50895576 AGAGCACTGTGGTTGACCCAAGG + Intergenic
1108507317 13:51124208-51124230 AGTGCTGATTGGTTGGCCCGGGG - Intergenic
1110462667 13:75762839-75762861 AAAGCAAAGGGGTTGACCCTGGG + Intronic
1114268133 14:21084717-21084739 AAGGAAAAGTGGTTGGCCCAGGG - Intronic
1114379059 14:22181246-22181268 AAAGCACAGTGGTTGGCATGTGG + Intergenic
1122127399 14:99586766-99586788 AGAGCAGAGTGGCTGGCTGGGGG - Intronic
1129894509 15:79093421-79093443 AGAGCTAAGTGGGTGGTCCCTGG + Intergenic
1130056073 15:80527175-80527197 CTAGCAAAGTGGCTGGCCTGTGG - Intronic
1132586867 16:709407-709429 AGAGCAAAGTGATTGCTCCGGGG + Intronic
1133037007 16:3039126-3039148 ACAGCAAAGTGCTTGGCCCATGG + Intergenic
1135895869 16:26401952-26401974 AGAGCAAAGTTGCTGGCACCTGG + Intergenic
1137741005 16:50774004-50774026 AGAGCCAACTGGATGGCCGGTGG - Intronic
1138510631 16:57506750-57506772 AGAGCAAAGTGGCTTGTCCCAGG - Intergenic
1146629237 17:34458221-34458243 AGAGCAAGGGGTTGGGCCCGTGG - Intergenic
1147644185 17:42024018-42024040 GGAGCAAAGTGGCTGGGGCGTGG - Exonic
1157186809 18:45547892-45547914 AGAGCAAAAGGGTTGGCCTGGGG + Intronic
1158245460 18:55427428-55427450 ACTGCAAAGTGTTTGGCACGGGG - Intronic
1165278683 19:34777791-34777813 AGAGCAAAATGGTGGGCACCAGG + Intergenic
1166357242 19:42234439-42234461 AGTGCAAAGCAGTTGGTCCGAGG - Exonic
930228761 2:48822400-48822422 AGAGAAAAGGGGTTGGCAGGGGG - Intergenic
933979236 2:87537130-87537152 AGAGCACAGTGGCTGGCTTGGGG + Intergenic
934492774 2:94773072-94773094 AGAGCACAGTGGTGAGCCCTGGG + Intergenic
934943311 2:98518353-98518375 AGAGCAGAGTGCTTAGCCCAGGG - Intronic
936314589 2:111413662-111413684 AGAGCACAGTGGCTGGCTTGGGG - Intergenic
937006332 2:118520092-118520114 AGAGCAAAGTGACAGGCCCAAGG + Intergenic
941065073 2:160892602-160892624 TGAGCAAAGTGGTTGGGACAGGG + Intergenic
942241596 2:173967301-173967323 AGAGCAAAGTACTTGGCCACAGG + Intergenic
945680830 2:212911996-212912018 ATACCAAAGTGGTTGGCACAAGG + Intergenic
946408913 2:219506915-219506937 GGAGCAATGTGGATGGCCTGGGG + Exonic
947031959 2:225806556-225806578 AGAGCAAAGTGGTCTGCCTCTGG + Intergenic
1170554510 20:17504663-17504685 AGAGAAGAGAGGTTGGCCCAGGG + Intronic
1170740453 20:19051481-19051503 AGAGCAAAGTTGTTGGGCAGTGG + Intergenic
1172106989 20:32522828-32522850 AGAGCTCAGTGGAGGGCCCGGGG + Intronic
1172448145 20:35003717-35003739 AGAGCTCTGTGGGTGGCCCGAGG - Intronic
1173523766 20:43716999-43717021 AGAGCACAGTGCTTGGCAGGTGG + Intergenic
1173621797 20:44442498-44442520 AGAGGAAAGTGGTTTGCCCTGGG + Intergenic
1174060018 20:47826157-47826179 AGTGCAGAGTGGGTGGCTCGAGG - Intergenic
1174071878 20:47905219-47905241 AGTGCAGAGTGGGTGGCTCGAGG + Intergenic
1174083586 20:47988932-47988954 AGAGCAAAGTGATTGGTCAGTGG - Intergenic
1174152172 20:48493450-48493472 AGTGCAGAGTGGGTGGCTCGAGG - Intergenic
1177769497 21:25498697-25498719 AGAGCAATGTTGTTGGCCCTAGG - Intergenic
1179384650 21:40930661-40930683 AGAGCAAAGTAGTTGGACCTAGG + Intergenic
955231181 3:57100147-57100169 AGAGCAAACTTGGTTGCCCGTGG + Intronic
955643130 3:61108419-61108441 AGAGCAAAGTCTTTGCCCTGTGG + Intronic
957717811 3:83953827-83953849 AGAGCAAAGTGTAAGGCTCGTGG + Intergenic
961519433 3:127458136-127458158 AGAGCACAGTGGCTGGACCCTGG - Intergenic
964196146 3:154067156-154067178 AGAGCATAGTGGCTGGCCGTAGG - Intergenic
967982400 3:195073495-195073517 AGAGCAAAGTGGCTGGGTTGTGG - Intronic
973582715 4:52359901-52359923 AGAGTTAAGTGGTTTGCCCAAGG - Intergenic
975597774 4:76066645-76066667 AGTGCACACTGGTTGGCCCATGG + Intronic
989132270 5:38119114-38119136 ATAGCAATATGGTTGGCCCTGGG - Intergenic
989256961 5:39376540-39376562 AGAGCAAAGCTGTTGGCGGGTGG + Intronic
992680892 5:79152088-79152110 AGAGCACAGTGGGAGGCCCCAGG + Intronic
997882916 5:137606273-137606295 ACAGCAAAGAGGGTGGCCTGAGG + Intergenic
998142359 5:139707352-139707374 AGAGCAAAGTGCCTGGCCCTGGG + Intergenic
1001640971 5:173244098-173244120 AGAGGAAAATGGTTGTCCTGGGG + Intergenic
1003007632 6:2396540-2396562 GAAGCAGAGTGGTTGGCCCAGGG + Intergenic
1006720564 6:36147494-36147516 AGAGCAAAGTCCTTAGCCTGTGG + Intergenic
1006749137 6:36365660-36365682 AGAGCAGAGAGGTGGGGCCGGGG + Intronic
1012251018 6:96980990-96981012 AGAGCAAAGTGGTGGGGCGGGGG + Intronic
1012329953 6:97972961-97972983 AGACCAAACTTGTTGGCCCTAGG + Intergenic
1013183464 6:107737428-107737450 AGGGCAGAGTGGTTGGATCGAGG - Intronic
1019105152 6:169661338-169661360 GGAGGAAAGTAGCTGGCCCGAGG + Intronic
1022503817 7:30898387-30898409 GGAGCAAGGTGGTGGGCCCATGG + Intergenic
1024014148 7:45295948-45295970 AGAGAAAAGTGTTAGGCCAGTGG + Intergenic
1031690511 7:124782437-124782459 AAAGGAAAGTGGGTGGCCGGGGG - Intronic
1031861163 7:126981865-126981887 TGAGAAAAGTGGTTGGCTCAAGG + Intronic
1033657656 7:143383777-143383799 AGAGCACAGTGCCTGGCACGTGG - Intronic
1034725318 7:153330478-153330500 AAAGCAAGGTGGTTGTCCAGAGG - Intergenic
1036613498 8:10370648-10370670 AGAGCAAAGTGGTTGGCCCGAGG - Intronic
1036992018 8:13608520-13608542 AGAGAAAACAGCTTGGCCCGGGG - Intergenic
1038104006 8:24413134-24413156 AGAGCACAGATGTTGGCACGGGG + Intergenic
1038447850 8:27616047-27616069 AGGGCAAAGTGATTAGTCCGAGG - Intergenic
1039627548 8:39069594-39069616 AGAGCTAAATGGTTTGCCTGAGG + Intronic
1041650255 8:60295089-60295111 AGAGAAAACAGGTGGGCCCGGGG - Intergenic
1047497520 8:125419227-125419249 AGAGCAGAGGGCTTGGCCAGCGG - Intergenic
1049216133 8:141409255-141409277 AGGGCAAAGTTCCTGGCCCGGGG + Intronic
1049596426 8:143485953-143485975 TGAGCATTGTGGCTGGCCCGTGG - Intronic
1050379234 9:5009169-5009191 TGAGCAAATTGGGTGGTCCGAGG + Intronic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1057230666 9:93319630-93319652 GGAGCAAAGAGGGTGGCCCCAGG - Intronic
1058345080 9:103951386-103951408 AGAGGAAAGGGGTTGGCTCTTGG - Intergenic
1059560005 9:115325079-115325101 AGAGCAAAGTGTTTGGAAAGGGG + Intronic
1060110206 9:120901534-120901556 AAAGCCAAGTGCTTGGCCCAAGG - Intergenic
1187254923 X:17633969-17633991 AAAGCAAAGAGGGTGGCCCTGGG - Intronic
1189371666 X:40433939-40433961 TTAGCACAGTGCTTGGCCCGTGG - Intergenic
1192079112 X:68030715-68030737 AGAGCAAAGTAGCTGGGCCTGGG + Intergenic
1192547621 X:72027032-72027054 AGAGGAAAGTGGTTGGCCTATGG + Intergenic
1194660499 X:96625084-96625106 AGAGATAAGAGGTTGGGCCGTGG - Intergenic
1195802875 X:108733376-108733398 AGAGATAAGGGGTTGGCACGTGG + Exonic
1198658826 X:138944195-138944217 AAAGCAAAGTGATTGGCCCAAGG - Intronic
1198844355 X:140894303-140894325 ATAGGAAAGTGGTTGACTCGTGG - Intergenic
1200216004 X:154368557-154368579 AGAGGAAGGTGGGTGGCCCTGGG + Intronic