ID: 1036613853

View in Genome Browser
Species Human (GRCh38)
Location 8:10373523-10373545
Sequence TACCTTGCCCAGCTACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036613845_1036613853 22 Left 1036613845 8:10373478-10373500 CCTCCTGCCTTGGCCTCCGAAAG 0: 197
1: 26816
2: 76391
3: 151703
4: 158987
Right 1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG No data
1036613850_1036613853 9 Left 1036613850 8:10373491-10373513 CCTCCGAAAGTGCTGGGATGACA 0: 21
1: 5359
2: 309440
3: 268748
4: 147961
Right 1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG No data
1036613844_1036613853 29 Left 1036613844 8:10373471-10373493 CCTTGATCCTCCTGCCTTGGCCT 0: 4
1: 60
2: 316
3: 680
4: 1300
Right 1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG No data
1036613846_1036613853 19 Left 1036613846 8:10373481-10373503 CCTGCCTTGGCCTCCGAAAGTGC 0: 453
1: 60050
2: 177761
3: 230826
4: 183590
Right 1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG No data
1036613852_1036613853 6 Left 1036613852 8:10373494-10373516 CCGAAAGTGCTGGGATGACAGGC 0: 2336
1: 222058
2: 272284
3: 184421
4: 142266
Right 1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG No data
1036613848_1036613853 15 Left 1036613848 8:10373485-10373507 CCTTGGCCTCCGAAAGTGCTGGG 0: 628
1: 84007
2: 208237
3: 235650
4: 154421
Right 1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036613853 Original CRISPR TACCTTGCCCAGCTACTGAC TGG Intronic
No off target data available for this crispr