ID: 1036615326

View in Genome Browser
Species Human (GRCh38)
Location 8:10383144-10383166
Sequence GAGTTGGCTGGCACCCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036615326_1036615328 -10 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615328 8:10383157-10383179 CAGCCAACTCTGCTGCCATCTGG No data
1036615326_1036615330 -6 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615330 8:10383161-10383183 CAACTCTGCTGCCATCTGGAAGG No data
1036615326_1036615335 11 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615335 8:10383178-10383200 GGAAGGGCAAGAAGGCTGCAGGG No data
1036615326_1036615334 10 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615334 8:10383177-10383199 TGGAAGGGCAAGAAGGCTGCAGG No data
1036615326_1036615337 18 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615337 8:10383185-10383207 CAAGAAGGCTGCAGGGGCAGAGG No data
1036615326_1036615336 12 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615336 8:10383179-10383201 GAAGGGCAAGAAGGCTGCAGGGG No data
1036615326_1036615339 30 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615339 8:10383197-10383219 AGGGGCAGAGGGCAATGTGCAGG No data
1036615326_1036615338 19 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615338 8:10383186-10383208 AAGAAGGCTGCAGGGGCAGAGGG No data
1036615326_1036615332 3 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615332 8:10383170-10383192 TGCCATCTGGAAGGGCAAGAAGG No data
1036615326_1036615331 -5 Left 1036615326 8:10383144-10383166 CCATGAAGGGTGCCAGCCAACTC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1036615331 8:10383162-10383184 AACTCTGCTGCCATCTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036615326 Original CRISPR GAGTTGGCTGGCACCCTTCA TGG (reversed) Intronic
900179541 1:1305176-1305198 GGGGTGGCTGGGACCCTTCAAGG - Intronic
900494907 1:2971971-2971993 CAGGTGGCTGCCACCCTCCAAGG - Intergenic
901770370 1:11527233-11527255 GAGTCTGCTGGCATCCCTCAGGG - Intronic
904722518 1:32521311-32521333 GAGTTTGCTGGCACCCTGGTGGG + Intronic
905266382 1:36756868-36756890 GAGTTGGCTGCCAGCCTGCACGG + Intergenic
914243974 1:145872460-145872482 GAGGTGCCTGGCTCCCTACACGG + Exonic
916789503 1:168112894-168112916 GAGTTGGCTTGCAGTCTTTAAGG + Intronic
917198518 1:172491909-172491931 GAGTTTGGTTGCAGCCTTCAAGG - Intergenic
917803916 1:178596770-178596792 GAGGTGGGTGGCCTCCTTCAGGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923446682 1:234077804-234077826 GTGCTGCCTGGCACCCTCCAGGG + Intronic
1063026419 10:2183429-2183451 GTGTTGGCTGGCACCCCTGTGGG - Intergenic
1067688365 10:48481521-48481543 GACTTGGGTGGCCCTCTTCAGGG - Intronic
1070491542 10:76981385-76981407 GAGAAGGCTGGAACCATTCAGGG + Intronic
1072447729 10:95514260-95514282 GAGTTAGCTGGCATCAGTCATGG - Intronic
1073285101 10:102382767-102382789 GAGTTGACTGGCACCATGGAGGG + Exonic
1075063014 10:119269895-119269917 GAGCTGGCTGGCCCCCTCCAAGG - Intronic
1077474669 11:2780666-2780688 CAGCTGGCTGGCACCCCTCCAGG + Intronic
1080108184 11:28534480-28534502 GATTTGGGTGGCACACTTTAAGG + Intergenic
1081936431 11:46907189-46907211 GATGTGGCTGGCAGCTTTCAAGG - Intronic
1083262745 11:61532047-61532069 GAGCTGGCTGGAACCCTACATGG + Intronic
1083471495 11:62887316-62887338 GAGCTGGCTGGCAGCCATCTGGG + Intronic
1084591191 11:70091630-70091652 GAGGTGGCTGGCACCCCTCAGGG - Intronic
1084678092 11:70648643-70648665 GAGAAGGCTGGCACCTTCCAGGG + Intronic
1089288078 11:117420348-117420370 GAGGTGGATGGCACCATTCCAGG - Intergenic
1091025318 11:132136255-132136277 GAGTGGACTGGCATCCTCCAAGG - Intronic
1092403621 12:8198919-8198941 GAGTTAGCTGGCAGACTTCTAGG + Intergenic
1093259535 12:16918118-16918140 GAATTGGGTGCCGCCCTTCAAGG + Intergenic
1093503023 12:19833942-19833964 GAGTTGGCTCTCACCCTTGTAGG - Intergenic
1098234314 12:68403866-68403888 CAGTTGCCTGGTACCCTGCAAGG + Intergenic
1099169463 12:79346562-79346584 GTGTTGGCTGCAACCCTACAGGG + Intronic
1101318383 12:103650518-103650540 GAGTAAGCTGGGACCCTTCACGG + Exonic
1102045518 12:109827966-109827988 GAGTGGGCTGGCCACCTTCTGGG - Intronic
1108761719 13:53575047-53575069 GAGTTAGCTTGCACTATTCATGG + Intergenic
1114684740 14:24518009-24518031 GAGTTGGCTGCCTCCATTCCTGG - Intergenic
1119774595 14:77240450-77240472 GGGGTGGCAGGCAGCCTTCAGGG - Intronic
1119888679 14:78165905-78165927 GAGGGGCCTGGCATCCTTCAAGG - Intergenic
1127452945 15:59134270-59134292 CAGTGGGTTGGCATCCTTCATGG + Exonic
1130698756 15:86157755-86157777 GAGTTGGCTGGAACCCTAATGGG + Intronic
1134458349 16:14410904-14410926 GAGTGGGTTGGGACCCTGCACGG + Intergenic
1137721373 16:50629566-50629588 GAGTTGGCTTGGCCCCTGCAGGG + Intronic
1141953816 16:87356582-87356604 GATTTGGTTAGCACGCTTCAGGG - Intronic
1142880348 17:2878688-2878710 GGGTTGGCTGGCTTCCCTCATGG - Intronic
1148135828 17:45291017-45291039 GAGTGGGCTGGCATCCTTGCTGG - Intronic
1148769657 17:50059517-50059539 CAGGTGCCTGGCAGCCTTCAAGG + Intronic
1152483318 17:80571161-80571183 GATTTGGCTGGCTACCTTAAAGG + Intronic
1152643580 17:81458980-81459002 CAGGCGGCTGGCACCCTTCCTGG - Intronic
1152682990 17:81679235-81679257 GTGTTGGCTGTCACCCTTATGGG + Intergenic
1156229988 18:35144119-35144141 GGGAAGGCTGGCACTCTTCACGG - Intergenic
1158236039 18:55315110-55315132 GCTTTGGCTGGCATCCTCCAGGG - Intronic
1158443996 18:57502787-57502809 GAAAAAGCTGGCACCCTTCATGG - Intergenic
1160266231 18:77342528-77342550 GGGTTGGGTGGCCACCTTCAGGG + Intergenic
1160697905 19:493524-493546 GGGATGGCTGGGACCCTCCATGG + Intronic
1161325533 19:3661966-3661988 CAGCTGGATGGCACCCTTCAGGG + Exonic
1163455965 19:17405815-17405837 CAGTTGGCTGGCACCCAGCTGGG - Intronic
928101236 2:28438594-28438616 GAGTTGGGTGGGACCCAGCATGG + Intergenic
930025812 2:47028510-47028532 GAGTTTGCTGCCTCCCTTCTCGG - Intronic
934943085 2:98516450-98516472 GAGTGGGCAGGGACCCTGCAGGG + Intronic
935555256 2:104502960-104502982 GAGTTGGCTATCATCCTTCCTGG + Intergenic
940773219 2:157860221-157860243 GAGTTGGTGGGTACCCTTCCTGG - Intronic
945290925 2:208126637-208126659 TAGTTGGTGGGCACCCTTCTGGG - Intergenic
946229102 2:218280649-218280671 GAGCTGGCTGACACCCCTCTGGG + Intronic
948364511 2:237446048-237446070 GAATTGGCTGGCACTCTCCTTGG + Intergenic
948525740 2:238569882-238569904 GAGCTGGCTGCCACCCCTCGAGG - Intergenic
1172226640 20:33309769-33309791 GACTTGGATGGCAGCCATCAGGG + Exonic
1172655180 20:36532480-36532502 GAGGTGGGTGGCAGCCTCCAAGG - Intergenic
1176062283 20:63177731-63177753 GACTTGCCTGGCTCCCTTCTCGG + Intergenic
1176083731 20:63286515-63286537 GAGGTGGCTGGCATCCTTGCTGG + Intronic
1176083748 20:63286569-63286591 GAGGTGGCTGGCATCCTTGCTGG + Intronic
1177141473 21:17362316-17362338 GAGTTGGCTGGCAGCCTTTCAGG + Intergenic
1183260345 22:36790774-36790796 GAGGTGGCAGGCACACTGCAGGG + Intergenic
949916181 3:8966405-8966427 TAGTTGCCAGGCACCCTTCTAGG - Intergenic
960041918 3:113158592-113158614 GTGTTTGCTGGGACCCATCAAGG - Intergenic
960395471 3:117131545-117131567 GAGTTCCCTGGCCCCGTTCATGG - Intronic
961339250 3:126206098-126206120 GAGGAGGCAGGCAGCCTTCAGGG - Intergenic
963001622 3:140687090-140687112 GAGTCTGCTGTCACACTTCAAGG - Intronic
964955206 3:162346434-162346456 CAATTGTCTGGCAGCCTTCATGG + Intergenic
971336466 4:25728061-25728083 AAGATGGCTGGCACCCTGTAAGG - Intergenic
971682355 4:29716916-29716938 GAGGTGGCTGGCACTCATCCAGG + Intergenic
974879534 4:67736893-67736915 AAGTTGGCTGTCACCATTCTAGG - Intergenic
986095545 5:4550383-4550405 TCGCTGGCTGGCACCCTCCATGG - Intergenic
988555250 5:32230975-32230997 GACTTGTCTGGCAACCTGCATGG + Intronic
993333133 5:86624227-86624249 TAGCTGGCTGCCACCCTCCAGGG + Intergenic
995537568 5:113152648-113152670 ATGTTGGCTGGCAGGCTTCAGGG + Intronic
996196145 5:120610025-120610047 GTTTTGTGTGGCACCCTTCACGG + Intronic
996562252 5:124843453-124843475 GACTTGGCTAGCACCCTTACAGG - Intergenic
997346344 5:133195249-133195271 GAGCTGGCTGGAAACCATCAGGG - Intergenic
998252495 5:140562328-140562350 GAGTTGGCTGGGCCCTTTAATGG - Intronic
998968753 5:147568797-147568819 GAGTTGGGTGGAAGCCTTGAAGG + Intergenic
1006806248 6:36791596-36791618 GAGTAGGGTGACACCCTGCATGG - Intronic
1007473919 6:42106898-42106920 GAGTCGGCTGGGAGCCTTCTTGG + Exonic
1008143432 6:47859587-47859609 CATGTGCCTGGCACCCTTCAGGG + Intergenic
1008152462 6:47971017-47971039 TAACTGGCTGGCAGCCTTCATGG - Intronic
1011155845 6:84330456-84330478 GAGATGCCTGGCACCCAGCAAGG + Intergenic
1013796655 6:113896221-113896243 AAGCTGGCTGGCTGCCTTCAAGG + Intergenic
1016933117 6:149428503-149428525 GTGTTGGCTGTCACACTTCCAGG + Intergenic
1017633548 6:156422474-156422496 GAGTTTCCTGGAACCCTTCGAGG + Intergenic
1017900894 6:158717856-158717878 GAGAGGGCTGGCTTCCTTCAAGG - Intronic
1019293355 7:261121-261143 GAAGGGGCTGGCACCCTTCACGG - Intergenic
1022684898 7:32587591-32587613 GAGAAGGCTGGGACTCTTCATGG + Exonic
1027185528 7:75968593-75968615 GAGTTTCCTGGCACCCTCCCCGG + Intronic
1029156453 7:98520990-98521012 GAGTTGGGTGGCGCCCTGGATGG + Intergenic
1029797512 7:102910697-102910719 GTGTTGGCTGTCACCCTTATGGG - Intronic
1030217855 7:107064619-107064641 TAGTTGGCGGGTACCCTCCAAGG - Intronic
1033455449 7:141499102-141499124 TATTTGGCTGGCAAGCTTCAGGG + Intergenic
1033975985 7:147101301-147101323 GAGTTCCCTGGACCCCTTCACGG + Intronic
1036615326 8:10383144-10383166 GAGTTGGCTGGCACCCTTCATGG - Intronic
1036844087 8:12150208-12150230 GAGTTAGCTGGCAGACTTCTAGG + Intergenic
1036865460 8:12392529-12392551 GAGTTAGCTGGCAGACTTCTAGG + Intergenic
1037689725 8:21171858-21171880 CAGCTGGCAGGCATCCTTCAGGG + Intergenic
1041185947 8:55300681-55300703 GAGTCTGCTGGCCACCTTCAGGG + Intronic
1047858118 8:128935091-128935113 CATTTGGCTGACACCCTTCACGG + Intergenic
1050629995 9:7549090-7549112 GAGGTGGCTGGCACGATCCATGG + Intergenic
1052894633 9:33735463-33735485 GAGTTGGCTGGCTTCCTGCTGGG - Intergenic
1061129315 9:128699362-128699384 GAGTTGGTTTGCACTATTCACGG + Intergenic
1062662448 9:137645205-137645227 ATGTTGCCTGGCACACTTCAGGG + Intronic
1185460869 X:332305-332327 GCTGTGGCTGGCACCTTTCATGG + Intergenic
1185753754 X:2636022-2636044 ATTTTGGCTGTCACCCTTCAAGG + Intergenic
1187856842 X:23644945-23644967 GAGGTGGTTGGCAGCCCTCAGGG - Intergenic
1192156778 X:68752853-68752875 GAGTTGGCTGGCCCCTTTGGGGG - Intergenic
1198629006 X:138614094-138614116 GAGCTGGCAGACACCCTTAATGG + Intergenic