ID: 1036615791

View in Genome Browser
Species Human (GRCh38)
Location 8:10386360-10386382
Sequence TCACCCCTGCCCCATTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 341}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036615791_1036615796 9 Left 1036615791 8:10386360-10386382 CCTAAGGAATGGGGCAGGGGTGA 0: 1
1: 0
2: 1
3: 35
4: 341
Right 1036615796 8:10386392-10386414 ATACCTGAAGCAGGAGGGAAGGG No data
1036615791_1036615794 4 Left 1036615791 8:10386360-10386382 CCTAAGGAATGGGGCAGGGGTGA 0: 1
1: 0
2: 1
3: 35
4: 341
Right 1036615794 8:10386387-10386409 CAGATATACCTGAAGCAGGAGGG No data
1036615791_1036615793 3 Left 1036615791 8:10386360-10386382 CCTAAGGAATGGGGCAGGGGTGA 0: 1
1: 0
2: 1
3: 35
4: 341
Right 1036615793 8:10386386-10386408 ACAGATATACCTGAAGCAGGAGG No data
1036615791_1036615798 13 Left 1036615791 8:10386360-10386382 CCTAAGGAATGGGGCAGGGGTGA 0: 1
1: 0
2: 1
3: 35
4: 341
Right 1036615798 8:10386396-10386418 CTGAAGCAGGAGGGAAGGGAAGG No data
1036615791_1036615792 0 Left 1036615791 8:10386360-10386382 CCTAAGGAATGGGGCAGGGGTGA 0: 1
1: 0
2: 1
3: 35
4: 341
Right 1036615792 8:10386383-10386405 TGAACAGATATACCTGAAGCAGG No data
1036615791_1036615795 8 Left 1036615791 8:10386360-10386382 CCTAAGGAATGGGGCAGGGGTGA 0: 1
1: 0
2: 1
3: 35
4: 341
Right 1036615795 8:10386391-10386413 TATACCTGAAGCAGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036615791 Original CRISPR TCACCCCTGCCCCATTCCTT AGG (reversed) Intronic
900795769 1:4707418-4707440 TTACCCCTTCCCCAAGCCTTGGG + Intronic
901177283 1:7313601-7313623 TTACCCCTGCCCCAATGCTAAGG - Intronic
902837864 1:19058370-19058392 TCACACCTGCCCACTGCCTTGGG + Intergenic
903730630 1:25492431-25492453 TCACTCCTGCTCTCTTCCTTTGG - Intronic
903935820 1:26894183-26894205 TGACCCCTGCTGCATTCTTTTGG - Intronic
904273658 1:29366613-29366635 TCACTCCTGCCCCCATCCTCAGG - Intergenic
904683985 1:32247748-32247770 TCATCCCTTCCCCATGCCTGTGG - Intronic
906231992 1:44171937-44171959 TCACCCCTGCCACAAGCATTTGG - Intergenic
906556981 1:46721787-46721809 TCAGCCCTGCCCCACTCCCCTGG - Intergenic
906950582 1:50332182-50332204 CCACCCCTGCCCAATTTCTTAGG + Intergenic
907557589 1:55358225-55358247 TCACCCCAGCCCCCTTCACTGGG - Intergenic
907688535 1:56638308-56638330 TCACCCCCACACCATTCCCTGGG + Intronic
908158876 1:61386417-61386439 TGATCCCTGCCCCATGCCCTGGG - Intronic
909568928 1:77086082-77086104 ACACCCCTACCCCACTTCTTTGG - Intergenic
910718404 1:90257726-90257748 TCACCCCTGCCCCCAAACTTTGG + Intergenic
911012816 1:93299702-93299724 CCACCCCTGCCCTTTTTCTTAGG + Intergenic
912045661 1:105452338-105452360 TCACCTCTTCCCCATTCATTAGG - Intergenic
912069728 1:105794986-105795008 TCACCTGTGCCCCAATGCTTGGG - Intergenic
912390497 1:109299296-109299318 TCACCCCTGGTACATTCCTGTGG + Intronic
913529020 1:119720091-119720113 GCTCACCTGCCCCATTTCTTAGG + Intronic
915953173 1:160203780-160203802 ACACCCCTGCCACATTCTCTAGG - Intergenic
916787345 1:168096241-168096263 TGTCCCCTGTCCCATTCTTTTGG + Intronic
917808927 1:178638647-178638669 TCAGCCCTTTCCCATTCCTCAGG + Intergenic
918363322 1:183781038-183781060 TTATCCCTGCCCCATCCCTCTGG - Intronic
921324547 1:213977900-213977922 TCACCACTGCCCCCTTCACTGGG + Intergenic
921572214 1:216793322-216793344 TCACCCCTGCTGTATTCCATTGG - Intronic
923706806 1:236350804-236350826 CCTCCCCTGCCCCATACCTGGGG + Intronic
1063366030 10:5491515-5491537 TCACCCCTGCCCCCCTCCCTGGG + Intergenic
1063408815 10:5820774-5820796 CCACCCCTGCCCCCATCCTTCGG + Intronic
1063522344 10:6752372-6752394 TCAGCCATGGCCCATTCCTTAGG + Intergenic
1064797336 10:19028210-19028232 TCAGCCCTGCATCATTCCTCTGG + Intergenic
1066688527 10:38003755-38003777 TCACCAGTTTCCCATTCCTTGGG - Intergenic
1067171134 10:43906854-43906876 TCTTCCCTGCCCCTTCCCTTGGG + Intergenic
1067208352 10:44238581-44238603 TCACCTTTCACCCATTCCTTGGG - Intergenic
1067943927 10:50678849-50678871 TCATCCCTGACCCATGGCTTGGG + Intergenic
1068957155 10:62828436-62828458 TGACCCCTGCCCCCACCCTTTGG + Intronic
1069738098 10:70670614-70670636 TTACCCCCGCCCCCTTCCCTGGG - Intergenic
1069774419 10:70918479-70918501 TCACCCAGGCTCCATTCCTCCGG - Intergenic
1069933135 10:71896943-71896965 TCACTCCTGCCCCAATCCCTGGG - Intergenic
1070158840 10:73853320-73853342 CCACCCCTGCCCCATCCTGTCGG + Intronic
1070179146 10:73997940-73997962 CCGCCCCTCCCCCATTCCTAAGG - Intergenic
1070495283 10:77015774-77015796 TCACTTCTGCCCAATTCATTGGG + Intronic
1070865417 10:79705718-79705740 TCATCCCTGACCCATGGCTTGGG + Intronic
1070879209 10:79843849-79843871 TCATCCCTGACCCATGGCTTGGG + Intronic
1071632315 10:87227939-87227961 TCATCCCTGACCCATGGCTTGGG + Intronic
1071645768 10:87360157-87360179 TCATCCCTGACCCATGGCTTGGG + Intronic
1073141992 10:101254225-101254247 CCACCCCTCCCCCATCCCCTAGG - Intergenic
1074082028 10:110175712-110175734 TGACCCTTGCCCCCCTCCTTTGG - Intergenic
1074112218 10:110430807-110430829 TCACACCTTCCCCTTTGCTTAGG + Intergenic
1075274794 10:121083744-121083766 TCACCCCCGCCCGCATCCTTTGG - Intergenic
1075585343 10:123653368-123653390 TCAGTCCTGACCCATTCATTTGG + Intergenic
1075897352 10:126008635-126008657 TCAGCCCTGCACCAGCCCTTGGG + Intronic
1076700654 10:132270995-132271017 TCACCCCTGGCTCCTCCCTTAGG - Intronic
1076731518 10:132441343-132441365 CCGCTCCTGCCCCATGCCTTTGG + Intergenic
1077295394 11:1824012-1824034 TCACCACTGGCCACTTCCTTTGG - Intergenic
1078067210 11:8086330-8086352 CCACCCCAGCACCATTCCTAAGG - Intronic
1079187938 11:18254062-18254084 TGACCCCTGCCACAGTCTTTGGG + Intergenic
1080396157 11:31891903-31891925 TCACTTTTGCCTCATTCCTTTGG - Intronic
1080697658 11:34617046-34617068 TTGCCCCTGCCCTGTTCCTTTGG - Intergenic
1081790194 11:45777136-45777158 TTACCCCTGCCCTATTTGTTTGG + Intergenic
1083721824 11:64607270-64607292 TCACCACCGCCCCATTGCTCTGG + Exonic
1083795516 11:65014439-65014461 TGGCCCCTGCCCCAGTCCTGGGG - Intronic
1084001780 11:66299482-66299504 TCACTTCTGCCCCTTTCCATCGG + Intergenic
1084915255 11:72424276-72424298 ACACCCTTGCCCCATGCCTGGGG + Intronic
1085837902 11:79975966-79975988 TTGCCCCTGCCACATTCCCTGGG - Intergenic
1089080627 11:115773575-115773597 GCACCCATGCCTCCTTCCTTGGG - Intergenic
1089784120 11:120895842-120895864 TTACCCTTTCCCCATTCATTTGG + Intronic
1090417218 11:126548781-126548803 TCACCCCTGCGCTGTTCCTATGG - Intronic
1091102325 11:132886628-132886650 TCACTTCTGCCACATTCCATTGG + Intronic
1091198613 11:133753174-133753196 CCGACCCTTCCCCATTCCTTGGG - Intergenic
1092216760 12:6689028-6689050 TCCCCCCTCCCCTTTTCCTTGGG - Intronic
1092421298 12:8334204-8334226 TCACCTCTGCCATATTCTTTTGG - Intergenic
1093184640 12:16005966-16005988 TCACCCCCTCCCCATTCCTGTGG + Intronic
1096199342 12:49670577-49670599 TCTCACCTGCCCCACTTCTTTGG - Intronic
1096214338 12:49791320-49791342 CCTCCTCTGCCCCATGCCTTTGG - Exonic
1096230995 12:49896872-49896894 CCAACCCTGCCCCATTCTGTCGG - Intronic
1096532045 12:52248466-52248488 TCACCCCTGCCCCCCTCCATGGG - Intronic
1096719691 12:53511946-53511968 TCATCACTCCCCCATTTCTTAGG - Intronic
1096755299 12:53794316-53794338 TCACCCCTGCCCCATCTATTAGG - Intergenic
1099544753 12:83964587-83964609 TAACCCCTGCCTCCATCCTTTGG + Intergenic
1100523656 12:95400133-95400155 TCAACCAGGCCACATTCCTTGGG - Intergenic
1103600265 12:122050383-122050405 TTACCCCTGCCCCTATCCTGGGG - Intronic
1104943457 12:132405360-132405382 GCTTCCCTGCCCCATGCCTTGGG + Intergenic
1104962667 12:132495600-132495622 GCACCCCTGCCCCATGGCTGTGG - Intronic
1106024948 13:25947652-25947674 TCACTCCTTCCCCATCCCTGTGG + Intronic
1106112244 13:26787181-26787203 CCAGCCCTCCCCTATTCCTTGGG - Intergenic
1107048964 13:36027173-36027195 TCACCCCACCCCCATTTCTGTGG - Intronic
1107078181 13:36346185-36346207 TCACCCCTGCGCGGTCCCTTGGG - Intronic
1107884832 13:44866541-44866563 ACTCCCTTGCCCCTTTCCTTTGG - Intergenic
1108144399 13:47461913-47461935 CCACCTCTGCCACATCCCTTAGG + Intergenic
1109313164 13:60719032-60719054 TATCCCCTGCCCCAGTCCTGGGG - Intergenic
1111899983 13:94188704-94188726 TCACCTCTGTCCCCTTCTTTAGG + Intronic
1112478893 13:99755842-99755864 TCAGCCCTGTCTCATTACTTGGG + Intronic
1113922768 13:113923351-113923373 TCACCCCTGCCCCATGTTTCGGG - Intergenic
1114577785 14:23729356-23729378 TCACCACTGCCCCCATCCTTAGG + Intergenic
1114621677 14:24099828-24099850 CCAACCCTGCTCCATTCCTCTGG + Intronic
1116813086 14:49557895-49557917 CCTCCCCTGCCCCATTCCTAAGG + Intergenic
1117074680 14:52090175-52090197 CCACCACTGCCCCATTACTATGG + Intergenic
1119780903 14:77276314-77276336 TCACCCCTCCCTCACTCCGTGGG - Exonic
1121263091 14:92580807-92580829 TCACCTGTGCCGCATTCCATTGG + Intronic
1121323209 14:93004847-93004869 TCTCCCCTGGCCCATGCCTGTGG - Intronic
1121904368 14:97726284-97726306 GCAACCCTGCCACATTCCCTGGG + Intergenic
1122151137 14:99726806-99726828 TCTCCCCTGCCCCGTCCCCTGGG + Exonic
1122919596 14:104874583-104874605 GCACCCCTGCCCACTTCCTGGGG + Intronic
1123036156 14:105472799-105472821 TCACCCCAGCCGCAGTCCCTGGG - Intergenic
1127696432 15:61452521-61452543 TCACCCCTCACCCATTGCTGAGG + Intergenic
1129053742 15:72805268-72805290 TCACGCCTGTCCCAGTACTTTGG + Intergenic
1129253831 15:74322857-74322879 TCTCCTCTGTCCCCTTCCTTGGG - Intronic
1130112184 15:80974663-80974685 TCCCCCCTCCCCCATTATTTTGG - Intronic
1131631396 15:94180777-94180799 TCACCCTTGTGTCATTCCTTAGG - Intergenic
1132907917 16:2293002-2293024 TGGCCCCTGCCCCATTCTATAGG - Intronic
1133565975 16:6993743-6993765 TCTCCCCTGCCCCATGCCCATGG - Intronic
1133575881 16:7089075-7089097 ACACCCTTGCCCCCTTTCTTTGG + Intronic
1134405211 16:13951733-13951755 TTCCCCCTGCCCCACTTCTTCGG - Exonic
1135800498 16:25489520-25489542 TCACCCCTTCCCCAGTTGTTAGG + Intergenic
1136229270 16:28877367-28877389 TCCACCCTTCCCCATTCCTTTGG + Intergenic
1136383464 16:29908125-29908147 TGTCCCCTCCCCCACTCCTTTGG - Intronic
1138136425 16:54527312-54527334 TCACCTCTGCTGCATTCCATTGG + Intergenic
1139675263 16:68519220-68519242 TCACCCTGTCCCCATTCCCTGGG - Intergenic
1139692523 16:68650270-68650292 CTGTCCCTGCCCCATTCCTTGGG + Intronic
1140101412 16:71920985-71921007 TTACACCTGCCCAATTCCTCTGG + Intronic
1141132830 16:81446788-81446810 TTCCCCCCTCCCCATTCCTTGGG - Intronic
1141306514 16:82869304-82869326 TCACACCTAACCCAGTCCTTTGG - Intronic
1141914241 16:87083365-87083387 TCACTTCTGCCATATTCCTTTGG + Intergenic
1142549411 17:728841-728863 TCTCCTCTCCCCCATTCCTCTGG - Intergenic
1142600350 17:1050795-1050817 TCTCCCCTGCCCCCTTCTTAGGG + Intronic
1143496718 17:7316661-7316683 TCACGCCTGTCCCAGCCCTTTGG + Intronic
1143569938 17:7750492-7750514 CCTCCCCTGCACCATTTCTTAGG - Intronic
1144164610 17:12597284-12597306 TCACCTCTGCGTCATTCATTGGG + Intergenic
1144238749 17:13288501-13288523 TCTCCCAGGCCCCATTCCATAGG - Intergenic
1144832405 17:18139139-18139161 TCACACCTGCCCCATGAGTTGGG - Intronic
1145780774 17:27561529-27561551 TCATCCCTTCCCCGCTCCTTGGG - Intronic
1146790094 17:35746109-35746131 TCTCCCCTGCCTCGTTCCTTTGG - Exonic
1147931957 17:43987362-43987384 TCTCCCCAGCCCTATTCCTCTGG + Intronic
1148796644 17:50200377-50200399 TCATCCCGCCCCCATTCCCTGGG + Intronic
1149431105 17:56596044-56596066 TCCCCCCCTCCCCATTCCTCGGG - Intergenic
1149573566 17:57695344-57695366 TCTGCCCTGCCCCTTTCCTGGGG + Intergenic
1149691172 17:58578122-58578144 CCACCCCCATCCCATTCCTTAGG + Intronic
1150377520 17:64694184-64694206 TCAACACTGCCCCGTTCCTGTGG + Intergenic
1150777155 17:68090307-68090329 TCAACACTGCCCCGTTCCTGTGG - Intergenic
1155175947 18:23301176-23301198 TGTCCCATGCTCCATTCCTTGGG + Intronic
1157328445 18:46686007-46686029 TCTCTCCAGCCCCATCCCTTTGG - Intronic
1157587785 18:48816257-48816279 TCACTCCTGCCTCATTCTATTGG + Intronic
1157914236 18:51649004-51649026 GCACTCCTACCCCATTCCATGGG - Intergenic
1157967252 18:52222349-52222371 TCCCCCCTCCCCCATTCCTGTGG + Intergenic
1159425708 18:68283172-68283194 TCAACCCTGCTCCATTCTATGGG + Intergenic
1160925168 19:1540807-1540829 TCACCCACACTCCATTCCTTTGG - Intergenic
1161284010 19:3459618-3459640 CCACCCCCGCCCCATTGCTGGGG + Intronic
1162523863 19:11196742-11196764 TCACCCCTTCCCCATTCCCCAGG - Intronic
1163773810 19:19206337-19206359 CCCTCCCTGCCCCATTCCCTGGG - Intergenic
1165331879 19:35144677-35144699 TCAGCCCTGCCCCCCTCCCTAGG - Intronic
1165335459 19:35166741-35166763 TCACTTCTGCCTCATTCCATAGG + Intronic
1165435774 19:35793954-35793976 TCACTCCTGCCCCAAGCCCTGGG + Intergenic
1165758470 19:38307557-38307579 TCACGCCAGCCCCAGCCCTTGGG - Intronic
1168122134 19:54257368-54257390 TCACCCCAGCCCCATCCCTGGGG - Intronic
1168580413 19:57551344-57551366 CCACATCTGCCCCATTCCTCTGG - Intronic
926283151 2:11466300-11466322 TCACCCCTGTTCCCTTCCTCTGG - Intergenic
926292453 2:11541702-11541724 TCAGCCCTGCCTAACTCCTTTGG + Intronic
927884086 2:26707818-26707840 TCTCCCCTGCACCCTGCCTTGGG - Intronic
928625059 2:33131135-33131157 TCACCCTTGCCCCATGCTTCGGG + Intronic
929040394 2:37738786-37738808 TCACACCTGCCCCTTTACCTGGG - Intergenic
929491986 2:42405394-42405416 TCACCCCTTCTGCATTCATTGGG + Intronic
933258719 2:80108380-80108402 TGCCCCCTACCCTATTCCTTTGG + Intronic
934133734 2:88973779-88973801 CCACCTCTGGCCCATTCTTTTGG - Intergenic
934138770 2:89023849-89023871 CCACCTCTGGCCCATTCTTTTGG - Intergenic
934224401 2:90118650-90118672 CCACCTCTGGCCCATTCTTTTGG + Intergenic
934886519 2:98030194-98030216 TCACCTCTGCCACATTCCCTTGG + Intergenic
934933382 2:98445972-98445994 CCACCCCACCCCCATTCCCTTGG - Intronic
936522914 2:113222875-113222897 TCATCCCTGTCTCATGCCTTTGG + Intronic
936982905 2:118280152-118280174 TCACAACAGCCCCATTCCATGGG - Intergenic
937296201 2:120811317-120811339 TCCCCCCAGCCTCATTCTTTGGG + Intronic
937858548 2:126690437-126690459 CCACCCCTGTCCAAGTCCTTAGG - Intronic
937859052 2:126694022-126694044 CCACCACTGCCCAAGTCCTTAGG - Intronic
938238301 2:129723829-129723851 TCTCCCTTGCCCCATCTCTTGGG - Intergenic
938289056 2:130139987-130140009 GCACCCCTGCCCCATCCCTGGGG - Intronic
938467474 2:131532951-131532973 GCACCCCTGCCCCATCCCTGGGG + Intronic
938600779 2:132836946-132836968 TCACCCATGTCCCTTTTCTTAGG - Intronic
941254428 2:163210808-163210830 TCACCCTTACCCCATATCTTGGG - Intergenic
943302779 2:186224009-186224031 CCACCACTGCCCCAGGCCTTTGG - Intergenic
943758344 2:191582512-191582534 TCACTTCTGCCACATTCCTTTGG - Intergenic
945379689 2:209125506-209125528 TCATCACTACCCCATCCCTTAGG + Intergenic
945411244 2:209510929-209510951 TCTCCCTTGTCCCATTCCTTAGG - Intronic
946005539 2:216521414-216521436 TCACCACTGCCCTATTCTTGAGG - Intronic
947183992 2:227438618-227438640 TCACCACTGTGTCATTCCTTAGG - Intergenic
947713606 2:232329313-232329335 TCACCACTGCCACATGCCTCAGG + Intronic
948276512 2:236713214-236713236 TCAGCCCTGCCCCTGTCCCTGGG + Intergenic
948283979 2:236769795-236769817 TCACCCCTGCCCATTGCCCTGGG - Intergenic
948431106 2:237919666-237919688 CCACCCCAGCCACAATCCTTGGG + Intergenic
948852783 2:240716565-240716587 TCACCCCTCACCCTTTCCTGGGG + Exonic
948921487 2:241067961-241067983 TCACCCCAGCCCCATGCTCTGGG - Intronic
1170215002 20:13882406-13882428 TCACTTCTGCCACATTCTTTTGG - Intronic
1170463020 20:16596838-16596860 TCACCCCACCCCCACTCCCTTGG + Intergenic
1171937859 20:31293201-31293223 TCACCCCTCCCCCATCCTCTGGG + Intergenic
1172424250 20:34844783-34844805 CCACCCCTACCCCATACCCTGGG + Exonic
1172868005 20:38114519-38114541 TCACTCCTGCCTTATTCCATTGG - Intronic
1173129338 20:40374222-40374244 TCACCTCTGTCCCCCTCCTTTGG + Intergenic
1174058834 20:47818166-47818188 TCATCCATGCCCCGGTCCTTTGG + Intergenic
1174120118 20:48258702-48258724 TGGCCCCTGCCCCATCCTTTGGG + Intergenic
1174339877 20:49888963-49888985 TGGCCCCTGCCCCAGTGCTTTGG - Exonic
1174739147 20:52995201-52995223 TTACCCCAACTCCATTCCTTGGG - Intronic
1174982098 20:55407994-55408016 TCACCACTGCCCCAGGCCTATGG + Intergenic
1176039390 20:63056343-63056365 ACACCCCTTCCCCCTTCCCTGGG + Intergenic
1177190760 21:17848576-17848598 TCACTTCTGCCACATTCTTTTGG + Intergenic
1178053397 21:28771897-28771919 TCACCCCTAGCCCCTTTCTTGGG - Intergenic
1179225159 21:39446420-39446442 TCACCCCTGACTGTTTCCTTAGG + Intronic
1179371365 21:40808985-40809007 TCACCACTGACCCATTCCCATGG + Intronic
1179424255 21:41260731-41260753 TCACTGCTGCCCCACTCCGTTGG + Intronic
1180731095 22:17983248-17983270 TCACCCCTCCCCATTTCCCTGGG + Intronic
1180957644 22:19748059-19748081 TCACCCCTGCCCCTTGCCACTGG + Intergenic
1181163881 22:20973449-20973471 TCACCCCTACCCCAGCCCTCAGG + Exonic
1183226584 22:36554275-36554297 TTACCTCTGCCACATTCCATTGG - Intergenic
1184040791 22:41942179-41942201 CCAGGCCTGCTCCATTCCTTTGG - Intronic
1185037432 22:48486810-48486832 TCACCACAGCCCCTGTCCTTTGG + Intergenic
950028938 3:9839232-9839254 TCACTCCTCCCCTTTTCCTTTGG + Intronic
950172370 3:10847890-10847912 TCACCCCTGCCCCTGGCCTGTGG + Intronic
950530742 3:13551036-13551058 GCGCCCCTGCCCCATCCCCTGGG - Intronic
950747495 3:15102160-15102182 TCACCCTTGCCCCCTGCCTTAGG + Intergenic
950858168 3:16124950-16124972 TCACCACTGCCCCAAATCTTGGG - Intergenic
952205880 3:31181298-31181320 CTGTCCCTGCCCCATTCCTTGGG + Intergenic
953451472 3:43010038-43010060 TCACCCCTACACTGTTCCTTTGG + Intronic
953600628 3:44360340-44360362 ACACCCTTGCCCCTTTTCTTAGG + Intronic
954274772 3:49535045-49535067 TCTCCCCTGCCCCAGTCCCCAGG + Exonic
955216650 3:56989712-56989734 CCACCCCTGCCCCACTCCCTAGG + Intronic
956393193 3:68796439-68796461 GCAACCCTGCCACATTCTTTTGG - Intronic
956783549 3:72623754-72623776 TCACCTCTGCCACAGTCCTTTGG + Intergenic
957019665 3:75111307-75111329 TCTCCCCTGTCCTTTTCCTTGGG + Intergenic
957792233 3:84956869-84956891 TCAGCCCTGCCCCATACCTGCGG - Intergenic
959566410 3:107836949-107836971 CCACCCCTGCCTCATTCCCCCGG + Intergenic
961316051 3:126036408-126036430 TGACCCCTGCACCCTTCCTATGG + Intronic
961463000 3:127064764-127064786 CCACCCCTGCCCCCGTCCTGAGG - Intergenic
961741634 3:129036619-129036641 TCAACCCTGTCCCATTCCTGAGG + Intronic
962901854 3:139768394-139768416 TCCCACCAGCCCCAATCCTTTGG + Intergenic
964319587 3:155481210-155481232 CCACTCCTGCCCCATTGCTGGGG + Exonic
966033876 3:175385904-175385926 TCTCCCCTCCCCTCTTCCTTGGG - Intronic
968075197 3:195812312-195812334 TCCCCGCTTCCCAATTCCTTGGG - Intergenic
968290775 3:197538008-197538030 TCATCACTGCACCATTTCTTGGG + Intronic
969046701 4:4341621-4341643 TCTCCCCTGCCCCAGGTCTTGGG + Intergenic
969377988 4:6775759-6775781 TCTCTCCTGCCCCATAGCTTAGG - Intergenic
969672401 4:8597035-8597057 GCACCCCTGCTCCACTCCCTGGG - Intronic
969908022 4:10415820-10415842 TCACCCCCACCCCAATCCTGTGG + Intergenic
973809538 4:54556749-54556771 TCACACCTGCTGCATTCCTATGG - Intergenic
975536235 4:75454231-75454253 TCACCCTCTCCCCATTCCTATGG - Intergenic
975827637 4:78336574-78336596 TCACCCCTCCTACATTCCTGAGG - Intronic
979412925 4:120401565-120401587 TCATAGCTGCACCATTCCTTGGG + Intergenic
980167650 4:129248652-129248674 TCAACCCAGCCCCAGTCCTCAGG - Intergenic
982470407 4:155782698-155782720 TCACTTCTGCCCCATTCGATTGG - Intronic
983773126 4:171574323-171574345 TTACCCCTTCCTCATTCCTGTGG - Intergenic
984935856 4:184888870-184888892 TCCCACCTGCCCCCTTCCTGGGG + Intergenic
984959096 4:185077341-185077363 TCCACCCTGCCCCTTTCCTTTGG + Intergenic
985813347 5:2107440-2107462 TCTCCCCTGCACCTGTCCTTTGG - Intergenic
986027486 5:3864631-3864653 TCACCTCTGCCACATTCCACAGG + Intergenic
988385475 5:30558924-30558946 TCACCCTTGTCCCTTACCTTAGG - Intergenic
988780507 5:34516889-34516911 TCAGCCCTGCTCCACTGCTTAGG + Intergenic
988901812 5:35741010-35741032 AAACCCATGCCCCATTCATTTGG + Intronic
989687569 5:44108131-44108153 TCACACCTGCCCCTTCCCTCAGG + Intergenic
992087293 5:73289344-73289366 TCACCTCTGCCTCAGTCCTCAGG + Intergenic
992180685 5:74195139-74195161 TCACCCCTACCCCTTTCCTTAGG - Intergenic
993374013 5:87127803-87127825 TCACCTCTGCAACATTCTTTTGG + Intergenic
993714714 5:91264616-91264638 TCACCTCTTCCCCAGCCCTTTGG - Intergenic
993734620 5:91461826-91461848 TCACGCCTGCCCCAGCACTTTGG + Intergenic
994173510 5:96684382-96684404 TGAGCCCTGCCCCATCCCATAGG - Intronic
995281632 5:110342053-110342075 TGGCCACAGCCCCATTCCTTTGG + Intronic
995837723 5:116414957-116414979 TAGCCCCTGCCCCATTCTTCAGG + Intergenic
995844170 5:116476147-116476169 CCAGCCCTGCCCCAGTCCTTGGG + Intronic
997079825 5:130725131-130725153 TCAACACTGCTCCTTTCCTTAGG - Intergenic
997098309 5:130938964-130938986 CCTCCCCTGCCCCATTACTCTGG - Intergenic
997352611 5:133241738-133241760 TCACACCTGCTGCTTTCCTTTGG + Intronic
997768406 5:136528066-136528088 TCATCCCTGCCATATTCTTTTGG + Intergenic
999348575 5:150845700-150845722 TCTCCCCTGCCCCACTCCGTGGG + Intergenic
999985855 5:157004736-157004758 TCACCTCTGCCACATTCTATAGG + Intergenic
1000178300 5:158780882-158780904 GGACCCATGCCCCATTACTTTGG + Intronic
1000998754 5:167985193-167985215 GCACCACAGCCCCATTCCTGGGG + Intronic
1001533831 5:172483949-172483971 TCACCTCTGCCCCATGCTATTGG - Intergenic
1002160704 5:177312473-177312495 TCAACCCCGCCCCATCGCTTGGG - Intronic
1004099490 6:12594309-12594331 TCTCCCCTGAGCCTTTCCTTAGG + Intergenic
1004673549 6:17820082-17820104 TCCCCTCTGCCCCAGTCATTTGG - Intronic
1005136260 6:22571542-22571564 TCACCCCTTCCCCTCTCCCTTGG + Exonic
1005559480 6:27023645-27023667 TCACTTCTACCCCATTCCATTGG - Intergenic
1006016037 6:31081740-31081762 CCTCCCTTGCCCCTTTCCTTAGG + Intergenic
1006191476 6:32212401-32212423 TCTCACCTGCCCCGTTCCTGTGG - Intronic
1006312771 6:33272491-33272513 ACACCCGCCCCCCATTCCTTAGG - Intronic
1006822277 6:36906747-36906769 TCACCCCTGCCTCATGCCCGGGG + Intronic
1009055078 6:58325361-58325383 TCACGCCTGCCACATTCTATTGG - Intergenic
1009236085 6:61125209-61125231 TCACGCCTGCCACATTCTATTGG + Intergenic
1010350420 6:74867512-74867534 TCACCAATGCCACATTCCATTGG + Intergenic
1010879346 6:81149363-81149385 TAACCCCTGCCTAATTCCATTGG - Intergenic
1011424032 6:87206186-87206208 TCACTTCTGCCCCATTCTCTTGG + Intronic
1013139427 6:107317237-107317259 TCACCTCTGCCCTATTCCAGAGG + Intronic
1013626600 6:111943859-111943881 TTTCCCCTGCCCCACTCCCTGGG + Intergenic
1014561726 6:122899294-122899316 TCCTGGCTGCCCCATTCCTTGGG + Intergenic
1014762569 6:125373292-125373314 TCTCCCCGGCCCCTTTCCTAGGG + Intergenic
1015694513 6:135965366-135965388 TCACTCCTGCTCCAGGCCTTTGG - Intronic
1016012513 6:139153005-139153027 TCAGCCTTGGCCCATTCCTGTGG - Intronic
1016062571 6:139645876-139645898 TCACACCTGCAACTTTCCTTTGG - Intergenic
1016774205 6:147886550-147886572 TCACCTTTGCCCTATTCCGTTGG - Intergenic
1017417335 6:154234934-154234956 TCATCTCTGCCCTATTCTTTCGG + Intronic
1019506475 7:1393914-1393936 GCACCCCTGCCCTCTGCCTTTGG - Intergenic
1023793167 7:43769946-43769968 TCACCCATGCCCCCTTCCCCGGG + Intronic
1024019335 7:45351196-45351218 TCACCGCTGTGTCATTCCTTGGG + Intergenic
1024605627 7:51020366-51020388 GCACCCCTGCCCCCTTCCTCTGG + Intronic
1024685273 7:51737790-51737812 TCACCCCTGCCCCAGTTCCGAGG - Intergenic
1025247847 7:57330930-57330952 CCACCCATGCCCCAGCCCTTCGG + Intergenic
1026592352 7:71707838-71707860 TCACTTCTGCTCCATTCCATTGG + Intronic
1027516424 7:79147741-79147763 TCCCTCCTGCTCCATTCCCTGGG - Intronic
1028161961 7:87496261-87496283 CTGGCCCTGCCCCATTCCTTGGG + Intergenic
1029297503 7:99552870-99552892 TCACTAATGCTCCATTCCTTAGG + Intronic
1029789425 7:102827086-102827108 TGACTTCTGCTCCATTCCTTTGG - Intronic
1030690370 7:112526420-112526442 TCACTTCTGCCCCATTCTGTTGG + Intergenic
1030773952 7:113510802-113510824 CATCCCCTGACCCATTCCTTAGG + Intergenic
1031476631 7:122230826-122230848 TCACCCCTGGCCTATTTTTTAGG - Intergenic
1034281381 7:149856816-149856838 CCTCCCCTGCACCCTTCCTTAGG - Intronic
1034581937 7:152050977-152050999 CCACCCCTCTCCCATTCCTGTGG - Intronic
1035057282 7:156044001-156044023 GCACCCCTATCCCACTCCTTGGG + Intergenic
1035627181 8:1079783-1079805 TCTCCTCTGCCCCATTGCTCTGG - Intergenic
1036615791 8:10386360-10386382 TCACCCCTGCCCCATTCCTTAGG - Intronic
1037794310 8:21978944-21978966 TCCACCCTGCCCTATTCCCTAGG - Intronic
1038030751 8:23637133-23637155 TCACCTCTGCCACATTCTCTTGG + Intergenic
1038597498 8:28902159-28902181 TCACCCCTGCCCCCTACCAGCGG - Intronic
1039266749 8:35833058-35833080 TCACCTCTGTCCCTCTCCTTGGG + Intergenic
1039465944 8:37784878-37784900 CCACCCCTGCCCCAGGCCCTGGG - Intronic
1041363489 8:57076061-57076083 TCACTCCTGCCACATCCCATGGG + Intergenic
1043383673 8:79728481-79728503 TCACCCCTGCCTCTCTCCTCTGG - Intergenic
1044541986 8:93418682-93418704 TCACCCCTGCCCCTCTCCCTGGG + Intergenic
1045416946 8:101976904-101976926 TCACTCCTGCCCCTTTGCCTTGG - Intronic
1047294636 8:123560156-123560178 TAACCGCTCCCCCTTTCCTTTGG + Intergenic
1047509257 8:125503921-125503943 TCCACTCTACCCCATTCCTTGGG - Intergenic
1047711715 8:127559210-127559232 TCTCTCCTTTCCCATTCCTTCGG + Intergenic
1047882790 8:129215072-129215094 TCACCCCTACCCAAGTCCTAGGG - Intergenic
1048945554 8:139443861-139443883 ACTCCCCTTCCCCATTCCCTAGG - Intergenic
1049179860 8:141216692-141216714 TCACCCCGGCCCCATCCCTCAGG + Intronic
1051047245 9:12889269-12889291 TCACCCCTGCACCAGCCCATGGG - Intergenic
1051419099 9:16872007-16872029 CCACCCCCGCCCCATTCTTGCGG - Intergenic
1051609194 9:18944979-18945001 TCACCCCTGCCCTCTTTCTCGGG + Intronic
1053452850 9:38207702-38207724 TCACCTCTGCCACATTCTATTGG + Intergenic
1053652420 9:40182534-40182556 TCTCCCATCCCCCATTCATTAGG + Intergenic
1053902820 9:42811842-42811864 TCTCCCATCCCCCATTCATTAGG + Intergenic
1054532161 9:66193687-66193709 TCTCCCATCCCCCATTCATTAGG - Intergenic
1055433722 9:76271112-76271134 TCATTCCTCCCCCTTTCCTTGGG + Intronic
1055556968 9:77484044-77484066 TCTCCCATGCCCCTTTTCTTTGG + Intronic
1056378369 9:86035728-86035750 CCACCCCACCCCCACTCCTTGGG - Intronic
1057355196 9:94326239-94326261 TCATCCCTGACCCATGGCTTGGG - Intronic
1058009508 9:99960871-99960893 TGACTCCTGCCTCCTTCCTTTGG - Intronic
1058779243 9:108316909-108316931 TCACTCCTGCCCCTACCCTTTGG - Intergenic
1058781267 9:108337806-108337828 TCACTCCTGCCACATTCCACTGG - Intergenic
1058972068 9:110092928-110092950 TCACCCCCACCCCATCCCTGGGG - Intronic
1059627835 9:116086663-116086685 TCACAACTGCCCCATTCTTTTGG - Intergenic
1060300686 9:122372993-122373015 ACACCCCTGCTCCCTTCCCTGGG - Intronic
1060409167 9:123388900-123388922 ACACCCCTGCCCCATTCTGTGGG + Intronic
1060521227 9:124295107-124295129 TCCCCGCTGCCCCCTTCCTCAGG - Intronic
1060741822 9:126103747-126103769 TCCCTCCTGCCACATTCCATTGG - Intergenic
1061358078 9:130121522-130121544 TTAGCCCTGCCCCATTTCCTAGG + Intronic
1061485460 9:130918361-130918383 CCACCCACCCCCCATTCCTTGGG - Intronic
1062009266 9:134258505-134258527 TCCCCGCTGCCCCATTGCTAGGG + Intergenic
1062111629 9:134785185-134785207 TCACCCCCACCCCATGCCTAGGG - Intronic
1062548039 9:137072480-137072502 CCAGCCCTTCCCCATCCCTTAGG - Intergenic
1185620419 X:1450453-1450475 TCTCCCCTCCCCCATTCCTAGGG + Intronic
1185620454 X:1450560-1450582 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185620468 X:1450595-1450617 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185620482 X:1450630-1450652 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185620496 X:1450665-1450687 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185620525 X:1450736-1450758 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185620565 X:1450842-1450864 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185620607 X:1450947-1450969 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185620622 X:1450982-1451004 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185620647 X:1451052-1451074 TCTCCCCTCCCCCATACCTAGGG + Intronic
1185620828 X:1451515-1451537 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185621048 X:1452089-1452111 TCTCCCCTCCCCCATCCCTAGGG + Intronic
1185621080 X:1452160-1452182 TCTCCCCAACCCCATTCCTGGGG + Intronic
1185621255 X:1452615-1452637 TCTCCCCTCCCCCATCCCTAAGG + Intronic
1186768857 X:12797761-12797783 TCATCCCTGGCATATTCCTTTGG - Intronic
1187374671 X:18741123-18741145 CCACCCACTCCCCATTCCTTAGG - Intronic
1187863597 X:23704135-23704157 TGACTCCTGTCCCCTTCCTTTGG + Intronic
1189287431 X:39861457-39861479 TAATCCCTGCCCCAATCCCTTGG + Intergenic
1190839480 X:54130964-54130986 GCACCACTGCGTCATTCCTTGGG + Intronic
1195034441 X:100959663-100959685 TCATCCTTGCCCCACTCCTCTGG + Intergenic
1195110347 X:101641609-101641631 TCACTCCTGCCACAATCCATTGG - Intergenic
1198187198 X:134265061-134265083 TCACCCCTGTCACATTCTATTGG + Intergenic
1200246527 X:154529483-154529505 TCCACCCTGGCCCATTCCATAGG - Intergenic