ID: 1036615794

View in Genome Browser
Species Human (GRCh38)
Location 8:10386387-10386409
Sequence CAGATATACCTGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036615791_1036615794 4 Left 1036615791 8:10386360-10386382 CCTAAGGAATGGGGCAGGGGTGA 0: 1
1: 0
2: 1
3: 35
4: 341
Right 1036615794 8:10386387-10386409 CAGATATACCTGAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036615794 Original CRISPR CAGATATACCTGAAGCAGGA GGG Intronic
No off target data available for this crispr