ID: 1036616764

View in Genome Browser
Species Human (GRCh38)
Location 8:10393819-10393841
Sequence GTGTGCACACGTGGTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036616764_1036616771 21 Left 1036616764 8:10393819-10393841 CCCTGTGCACCACGTGTGCACAC 0: 1
1: 0
2: 0
3: 14
4: 104
Right 1036616771 8:10393863-10393885 TTTGTGCATGTACATGCATAGGG No data
1036616764_1036616772 25 Left 1036616764 8:10393819-10393841 CCCTGTGCACCACGTGTGCACAC 0: 1
1: 0
2: 0
3: 14
4: 104
Right 1036616772 8:10393867-10393889 TGCATGTACATGCATAGGGTTGG No data
1036616764_1036616770 20 Left 1036616764 8:10393819-10393841 CCCTGTGCACCACGTGTGCACAC 0: 1
1: 0
2: 0
3: 14
4: 104
Right 1036616770 8:10393862-10393884 CTTTGTGCATGTACATGCATAGG No data
1036616764_1036616768 -3 Left 1036616764 8:10393819-10393841 CCCTGTGCACCACGTGTGCACAC 0: 1
1: 0
2: 0
3: 14
4: 104
Right 1036616768 8:10393839-10393861 CACCTACATGGTCACTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036616764 Original CRISPR GTGTGCACACGTGGTGCACA GGG (reversed) Intronic
902287680 1:15417128-15417150 GTGTGCACACCTGGTGAAGCTGG - Intronic
903238255 1:21964761-21964783 GTGTGCACCAGTGCTGTACACGG + Intergenic
912933462 1:113983555-113983577 TGCGGCACACGTGGTGCACAGGG + Intergenic
912942110 1:114054282-114054304 GTGTGCATGTGTGGTGTACATGG + Intergenic
918471450 1:184879971-184879993 GTGTGCACACGGGTTGAAAACGG - Intronic
920772554 1:208903184-208903206 GTTTGCACATGTGGGGCACAAGG - Intergenic
922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG + Intergenic
1063102384 10:2962050-2962072 GTGGGAACTTGTGGTGCACAGGG - Intergenic
1069691794 10:70358573-70358595 TGGGGCAGACGTGGTGCACAAGG - Intronic
1070815472 10:79320015-79320037 GTGTGCACCTGTGGTGAACTGGG + Intergenic
1073045858 10:100637842-100637864 GTGTACACACAGGATGCACATGG - Intergenic
1077049181 11:559088-559110 GTGGCCACACGAGGCGCACACGG - Intronic
1078845538 11:15115750-15115772 GTGTGCAAGACTGGTGCACATGG - Intronic
1084760906 11:71270298-71270320 GTGTGCCCAGGTGGCCCACAGGG - Intergenic
1091591760 12:1846664-1846686 GTCTGAACACGTGGTGGACATGG - Exonic
1093641631 12:21533929-21533951 GTGTCCTCACGTGGTGGAAAGGG + Intronic
1101442812 12:104716104-104716126 GTCTGCACACGGGGTGCCAAGGG + Intronic
1102571925 12:113831960-113831982 GTGCGCCCAAGTGGTGCACATGG - Intronic
1106385597 13:29282400-29282422 GTATGCACAGGTGGGGCACAGGG - Intronic
1107987168 13:45785601-45785623 ATGTGCACACATGGTGCACTGGG + Intronic
1108492464 13:50994872-50994894 GTGTCCACACGTGTTCCCCAGGG - Intergenic
1112353607 13:98656466-98656488 GTGTGCAAAGGTGGTGAAAAGGG + Intergenic
1112670268 13:101627599-101627621 GGGTGAACAGGTGGAGCACAGGG - Intronic
1113519787 13:110932050-110932072 GCATGCAAACGTGGTGCACATGG - Intergenic
1118823555 14:69360873-69360895 GTGTCACCACGTGGTGCAGAAGG + Intergenic
1122273363 14:100578240-100578262 GTGAGCTCCCATGGTGCACAGGG + Intronic
1122938286 14:104969984-104970006 GTGTGCTTGCTTGGTGCACAGGG - Intronic
1124995453 15:34719385-34719407 GTCTGCACACAAAGTGCACATGG + Intergenic
1127686274 15:61348568-61348590 GTGTCCTCACATGGTGGACATGG - Intergenic
1128241841 15:66106735-66106757 GTGTGTCCACGTGGTGCATATGG - Intronic
1134859967 16:17552376-17552398 GTGTGAAGACGTGGTGCGGAAGG - Intergenic
1135303021 16:21347080-21347102 GGGTGCACACATGCTGCACAAGG + Intergenic
1136299765 16:29326272-29326294 GGGTGCACACATGCTGCACAAGG + Intergenic
1139424768 16:66872865-66872887 GTGTGCACACGGGGAGGAAAAGG + Intronic
1140826352 16:78710209-78710231 GCGTGCACACTTGGGGCACCTGG + Intronic
1141501419 16:84446969-84446991 GTGTGCACACGTGTTGTCCCTGG + Intronic
1203166069 17_GL000205v2_random:96726-96748 GTGTGCACTCTCGGTGCCCATGG + Intergenic
1154906391 18:20578247-20578269 ATGTGGACACTTGGTGCGCATGG - Intergenic
1157816068 18:50730097-50730119 GAGACCACATGTGGTGCACAGGG + Exonic
1160040565 18:75341394-75341416 GGGTGCACTCGGGGTGGACACGG + Intergenic
1161768239 19:6218296-6218318 GAGAGCCCACGTGGTCCACACGG - Intronic
1163649239 19:18507549-18507571 GTGTGCAGTGGTGGTGGACATGG - Intronic
1165251589 19:34541007-34541029 GTGTGTGTATGTGGTGCACAGGG - Intergenic
1166798007 19:45439752-45439774 GTGTGCACGCGGGGTGTCCAGGG + Intronic
1167037600 19:47003305-47003327 GTGTGCACAGAGGGTGCTCATGG + Exonic
1167734960 19:51288552-51288574 GTGTCCTCACATGGTGTACAGGG + Intergenic
930673818 2:54179059-54179081 GTGTCCTCACATGGTGCAAAGGG + Intronic
931150686 2:59569679-59569701 GTGTGGTCACATGGTGCAAAAGG + Intergenic
938971643 2:136438420-136438442 GTGTCCCCATGTGGTGGACAAGG - Intergenic
942063824 2:172251893-172251915 GTGTTCATACGTGGTGAAGAAGG - Intergenic
942491289 2:176491690-176491712 GACAGCACACTTGGTGCACAAGG - Intergenic
1168788460 20:559653-559675 GGATGCACAGGTGGAGCACAGGG + Intergenic
1175952916 20:62592837-62592859 GTGAGCCCTCATGGTGCACATGG + Intergenic
1176335460 21:5593816-5593838 GTGTGCACTCTCGGTGCCCATGG - Intergenic
1176392297 21:6227132-6227154 GTGTGCACTCTCGGTGCCCATGG + Intergenic
1176405686 21:6362370-6362392 GTGTGCACTCTCGGTGCCCATGG - Intergenic
1176469122 21:7089042-7089064 GTGTGCACTCTCGGTGCCCATGG - Intergenic
1176492683 21:7470820-7470842 GTGTGCACTCTCGGTGCCCATGG - Intergenic
1176507959 21:7667563-7667585 GTGTGCACTCTCGGTGCCCATGG + Intergenic
1179567018 21:42255520-42255542 GTGTGCACACTGTGTGTACAGGG + Intronic
1179659368 21:42864653-42864675 GTGTGCAAACGTGCTGCATCCGG - Intronic
1181442025 22:22941669-22941691 GTGTGCACATGTGGGGCTGAGGG + Intergenic
1183229843 22:36574923-36574945 GTGTGCAGATGTGGAGCACAGGG + Intronic
1183549518 22:38473512-38473534 GTGTACACATATGATGCACATGG - Intronic
1184198859 22:42951331-42951353 GTGCACACCCGTGGTGCCCAGGG + Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1184912262 22:47543918-47543940 GTGTCCTCACATGGTGGACAGGG - Intergenic
1185119015 22:48954780-48954802 TTGTGCACACGTGGCTCAGAGGG + Intergenic
949885965 3:8694275-8694297 GGGTACACACATGGTGTACACGG + Intronic
951627873 3:24686411-24686433 GTGTCCTCACGTGGCACACAAGG + Intergenic
956465017 3:69511500-69511522 GTGGGCACATGTGGTGGCCATGG + Intronic
957733591 3:84177403-84177425 GTGTTAACATGTGGTGCACATGG + Intergenic
957733593 3:84177438-84177460 GTGTTAACATGTGGTGCACATGG + Intergenic
957993371 3:87654450-87654472 GTATTCACAAGTGATGCACATGG + Intergenic
960720035 3:120616655-120616677 GGGTGCTCAGGTGGGGCACAGGG - Intergenic
961274140 3:125713661-125713683 GTGTACACACATGGTGTACACGG + Intergenic
961317515 3:126050661-126050683 GTGTGCAGACTCGGGGCACAAGG + Intronic
961382049 3:126501395-126501417 GTGTGCAAACGTGGGGGCCATGG + Intronic
961541823 3:127605231-127605253 GAGTGAACACGTGAAGCACAGGG + Intronic
963627612 3:147692885-147692907 GTGTTCTCACGTGGTGAAAAAGG + Intergenic
966695911 3:182790867-182790889 ATGTGCACACAGTGTGCACATGG - Intergenic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
971222083 4:24717557-24717579 GTGTCCTCACATGGTGGACAGGG - Intergenic
972739585 4:41877693-41877715 GAGAGCACACGTGGGGCACCTGG + Intergenic
976791169 4:88880429-88880451 GTGGGCACTCTTGGTCCACAGGG + Intronic
980189380 4:129503930-129503952 GTGTGCACACGTGTGACAGAGGG + Intergenic
984689055 4:182704784-182704806 GTGTGCACACGTGCTTTAAAGGG - Intronic
984864960 4:184273405-184273427 TTGTGCACAAGTGGTGTTCAGGG - Intergenic
985846596 5:2354154-2354176 CTGTGCTCTCTTGGTGCACATGG + Intergenic
997379971 5:133428610-133428632 GTGTGACCACTTGGTGCTCAGGG - Intronic
1000459087 5:161490369-161490391 TTGTGAACACATGGTTCACAAGG + Intronic
1001566593 5:172703487-172703509 GAGTCCACACGTGGTGCAAGGGG + Intergenic
1002325629 5:178403724-178403746 TTGGGCACAGTTGGTGCACAGGG - Intronic
1002419595 5:179138721-179138743 GTGTTCACACGTGCTGCTGAGGG + Intronic
1004081098 6:12394048-12394070 GTGTGCTGACTTAGTGCACAGGG + Intergenic
1014775909 6:125509630-125509652 GTGTGCTCACGTGGTGGAAGGGG - Intergenic
1015023525 6:128505660-128505682 GAGTGCACAAGTGTTACACAAGG + Intronic
1019023871 6:168941826-168941848 GTGGGAACACCAGGTGCACAGGG + Intergenic
1024239620 7:47424302-47424324 GTGTGCACAGGTGCAGCAAAGGG - Intronic
1031775870 7:125908761-125908783 GTGACCACAGGTGGTCCACATGG + Intergenic
1035983003 8:4393848-4393870 ATGTACACACATGGAGCACACGG + Intronic
1036616764 8:10393819-10393841 GTGTGCACACGTGGTGCACAGGG - Intronic
1037625747 8:20605390-20605412 GCGTGCTCATGTGGTGGACAGGG - Intergenic
1037904171 8:22705558-22705580 GTGTGTACAGGTTGTGAACAAGG + Intergenic
1040617143 8:49048131-49048153 GTGTGCAGGAGCGGTGCACACGG - Intergenic
1041632484 8:60103616-60103638 CAGTGCACAAGGGGTGCACATGG + Intergenic
1043334450 8:79157180-79157202 GTGTGCATCCGTAGTGCACGTGG - Intergenic
1045108139 8:98913647-98913669 GTGGGCACATGTGGTGCAACAGG - Intronic
1046284252 8:112074245-112074267 AGGTGCACACATGGTGCACGTGG - Intergenic
1049757483 8:144317186-144317208 CTGTGCACAAGTGGTGCATCAGG - Exonic
1051349229 9:16183370-16183392 GTGCAAAGACGTGGTGCACAAGG + Intergenic
1056428513 9:86503258-86503280 ATGTGCCCACATGGTACACAGGG + Intergenic
1060712968 9:125889287-125889309 GTCTGCACACGTGGGGAGCAGGG + Intronic
1061302640 9:129714478-129714500 GTGGCCACACGTGGAGCACTTGG + Intronic
1062177272 9:135170720-135170742 GGGGGCCCACGTAGTGCACAGGG + Intergenic
1203426176 Un_GL000195v1:41086-41108 GTGTGCACTCTCGGTGCCCATGG + Intergenic
1203440068 Un_GL000195v1:181975-181997 GTGTGCACTCTCGGTGCCCATGG - Intergenic
1190227885 X:48560023-48560045 GTGTGCAAACTTGGTGGCCATGG - Exonic
1198463261 X:136882921-136882943 GTGTTCTCACATGGTGGACAGGG - Intergenic