ID: 1036619013

View in Genome Browser
Species Human (GRCh38)
Location 8:10410634-10410656
Sequence CAGAACCAGGAGAAGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036619009_1036619013 12 Left 1036619009 8:10410599-10410621 CCTCAAGGTCAGCTCCTGAAGGT 0: 1
1: 0
2: 3
3: 15
4: 156
Right 1036619013 8:10410634-10410656 CAGAACCAGGAGAAGAGCCCAGG No data
1036619007_1036619013 17 Left 1036619007 8:10410594-10410616 CCAAGCCTCAAGGTCAGCTCCTG 0: 1
1: 0
2: 1
3: 50
4: 483
Right 1036619013 8:10410634-10410656 CAGAACCAGGAGAAGAGCCCAGG No data
1036619011_1036619013 -2 Left 1036619011 8:10410613-10410635 CCTGAAGGTCATGCTGTTTGGCA 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1036619013 8:10410634-10410656 CAGAACCAGGAGAAGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036619013 Original CRISPR CAGAACCAGGAGAAGAGCCC AGG Intronic
No off target data available for this crispr