ID: 1036621100

View in Genome Browser
Species Human (GRCh38)
Location 8:10424903-10424925
Sequence CTGCTCCTTCGCTGTCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036621100_1036621110 27 Left 1036621100 8:10424903-10424925 CCCGGGGGACAGCGAAGGAGCAG 0: 1
1: 0
2: 3
3: 41
4: 300
Right 1036621110 8:10424953-10424975 GACGTGAATCTGAACAGTGGCGG No data
1036621100_1036621111 30 Left 1036621100 8:10424903-10424925 CCCGGGGGACAGCGAAGGAGCAG 0: 1
1: 0
2: 3
3: 41
4: 300
Right 1036621111 8:10424956-10424978 GTGAATCTGAACAGTGGCGGAGG No data
1036621100_1036621109 24 Left 1036621100 8:10424903-10424925 CCCGGGGGACAGCGAAGGAGCAG 0: 1
1: 0
2: 3
3: 41
4: 300
Right 1036621109 8:10424950-10424972 CAAGACGTGAATCTGAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036621100 Original CRISPR CTGCTCCTTCGCTGTCCCCC GGG (reversed) Intronic
900154272 1:1197795-1197817 TTCCTCCTTGGCTGTCCCCGGGG - Exonic
900486189 1:2923905-2923927 CTGCTCCTTCTGTGGCACCCTGG - Intergenic
900750567 1:4394543-4394565 CTGTTCCTTCACTCTCCCCTTGG - Intergenic
900792637 1:4690239-4690261 CCGCTCCTTCACTGTCACCAGGG + Intronic
901201840 1:7471619-7471641 CTGCTCCTCCCCTGACCCACTGG - Intronic
902920453 1:19663525-19663547 AGGCTCCTGCGCTGTCCCCAGGG - Intergenic
903379176 1:22885101-22885123 CTGCTCCTTCGAGGCCCTCCAGG - Intronic
903815651 1:26062503-26062525 CTGCTCCTTCTCTGAGCCTCAGG - Intronic
903887403 1:26548375-26548397 CCGCTCCTTAGGTGTCCCCTTGG - Intronic
904809877 1:33156528-33156550 CTGCTCCTTCTCGGTCTCCTTGG + Intronic
905629927 1:39512728-39512750 CTTCTCCTTCCCTTTCACCCAGG - Intronic
905667832 1:39773462-39773484 CTTCTCCTTCCCTTTCACCCAGG + Intronic
905868752 1:41391164-41391186 CTGCTCCATCCCTGCCACCCTGG - Intergenic
912372610 1:109185553-109185575 CTGCTGCTTCTCTTTCCTCCAGG + Intronic
912950742 1:114118646-114118668 CTGCTCCCCGGCTGTCCCCGCGG + Intronic
914720120 1:150282562-150282584 CAGCTCCTTCGCCGTCTCTCCGG - Intronic
915120326 1:153626533-153626555 CTGCTCCTTCTCTCTTCCACAGG - Exonic
915791625 1:158678246-158678268 CTTCTCCTTTGCTGTCCCAAAGG + Intronic
916787848 1:168099131-168099153 CTGCTTCTGCGATGACCCCCAGG + Intronic
916890316 1:169106834-169106856 CTCCTCCTTGGCTTTCCCGCGGG - Exonic
917804193 1:178598554-178598576 CTGCTCCTCCCCTGGCTCCCAGG - Intergenic
921039528 1:211416646-211416668 CTGCTGCCTCGGCGTCCCCCGGG - Intergenic
921298694 1:213728810-213728832 CAGCTCCTCCGCTGTGCCTCGGG + Intergenic
922721288 1:227901491-227901513 CTCCTCCTTGGCTGTACCCAGGG + Intergenic
1062833949 10:624040-624062 CTGCTCCTTCTCTCTGCACCCGG + Intronic
1063519170 10:6725391-6725413 CTGCTCCCTAGCTGTTCCCCAGG - Intergenic
1064181560 10:13120900-13120922 CTTCCCCTTCGCTTTCCGCCAGG - Intronic
1066089800 10:32006054-32006076 CTGCTACCTGTCTGTCCCCCAGG - Intergenic
1067233096 10:44425637-44425659 CTGAGCCATGGCTGTCCCCCAGG - Intergenic
1067570117 10:47365366-47365388 CTTCACCTACGCTGTCTCCCTGG - Intergenic
1069774432 10:70918555-70918577 CTGCTGCTTCTCTGTCGCCCGGG - Intergenic
1070481722 10:76889569-76889591 CTGTTCTTTTGCTGTCTCCCAGG - Exonic
1073101072 10:101006963-101006985 CTGCTCCTTCTCTGCCTGCCAGG - Exonic
1073349124 10:102806847-102806869 CAGCTCTTTCTCTGTCCCCCTGG - Intronic
1074079606 10:110157169-110157191 CTGCTTCTTCACTGGCCCACGGG - Intergenic
1074184521 10:111089021-111089043 TTGCTGCTTCGCTGCACCCCAGG + Intergenic
1074298091 10:112209598-112209620 CTGCTGCTTCATGGTCCCCCTGG + Intronic
1076365597 10:129919540-129919562 CTGCTCCTAAGCTGGCCCCTGGG - Intronic
1076751928 10:132547564-132547586 CTGCACCCTCGCCGTCGCCCTGG + Intronic
1076771749 10:132669881-132669903 CTGCTCCCTCTCTGTCCTCAGGG + Intronic
1077159099 11:1104561-1104583 CTGTCCCTGAGCTGTCCCCCTGG + Intergenic
1077487902 11:2847455-2847477 CTCCTCCTTCTCTGCTCCCCAGG - Intronic
1078670838 11:13363841-13363863 CTGCTCCTTAGCTGTCCTTCGGG + Intronic
1083366230 11:62143016-62143038 TTGTTCTTTCCCTGTCCCCCTGG - Intronic
1084026302 11:66452250-66452272 CCTCTGCTTCCCTGTCCCCCAGG - Intronic
1084065248 11:66700454-66700476 CTGCTCCTTCACATTTCCCCGGG + Intronic
1084267463 11:68012378-68012400 CTGGTCCTGCCCTGGCCCCCAGG + Intronic
1085330818 11:75649420-75649442 CTGCTTCTTCCCTTGCCCCCTGG - Intronic
1089514634 11:119024776-119024798 CTGCGCCTTTTCTGTCACCCGGG - Exonic
1089779746 11:120865382-120865404 CTGCTCCCTCGCTGACCCACAGG - Intronic
1090014508 11:123074198-123074220 ATGCTCTTTCTCTGTCACCCAGG + Intronic
1090069375 11:123530453-123530475 CTGCAACTTCCCCGTCCCCCCGG + Intronic
1091173042 11:133535200-133535222 CTGCTCCTTCTCTCTCCTCCTGG - Intergenic
1091603410 12:1931089-1931111 CTGCTCCTCTGATGTGCCCCCGG - Intergenic
1091818084 12:3454528-3454550 CTGCTCCTCCTCTCTCCTCCAGG - Intronic
1092180460 12:6443275-6443297 CTGCTCCTGCTCTGACCCCCTGG + Intergenic
1093638041 12:21494688-21494710 CCACTCCCTTGCTGTCCCCCAGG + Intronic
1095577576 12:43758285-43758307 GGGCTCCTTTGCTGTCCTCCAGG - Exonic
1096242514 12:49967042-49967064 CTGCTCCTTCCCTGGGCTCCCGG - Intergenic
1096277068 12:50218542-50218564 GTGCTTCTTCCCTGTCTCCCAGG + Intronic
1096519037 12:52173866-52173888 CTGCTCCCTTCCTGTCCCTCTGG + Intronic
1097925902 12:65126024-65126046 CTTCTTCTTCCCTGTCCCTCCGG - Intergenic
1099812745 12:87605512-87605534 TGTCTCCTTCCCTGTCCCCCAGG - Intergenic
1100321889 12:93503014-93503036 CTGTTCCTCCCCCGTCCCCCAGG + Exonic
1102562524 12:113772492-113772514 CTGACACTTCCCTGTCCCCCTGG + Intergenic
1103212614 12:119178095-119178117 CTCATCCTCCGCGGTCCCCCAGG + Intergenic
1103407434 12:120686276-120686298 CTGCTCCTTCACAGTTCACCTGG - Intergenic
1103916476 12:124378384-124378406 CTGCTGCTTCCCTGTGCCCCAGG - Exonic
1104346593 12:128005182-128005204 CTGCTCCTTTGCTGTACACGTGG + Intergenic
1104721133 12:131045774-131045796 CAGCTCCCTCGCTGGCCGCCTGG - Intronic
1104744651 12:131203192-131203214 CTGCTCCTTCCGTCTCCCCAGGG - Intergenic
1104802718 12:131565663-131565685 CTGCCCCTTTGCTGTTCCCAAGG - Intergenic
1104842868 12:131832933-131832955 CAGCTCCTTCCGTGTCCCCCAGG + Intronic
1104876513 12:132038744-132038766 CTGTTCCCTCCCTGTCCCCGTGG + Intronic
1104970317 12:132528007-132528029 CTCCTCCATCTTTGTCCCCCTGG + Intronic
1107245107 13:38284638-38284660 GTGCTGCTTCTCTGTCCCCCAGG - Intergenic
1109957999 13:69593375-69593397 CTGCTCCATCTCTGTCCACGTGG + Intergenic
1110630090 13:77697816-77697838 CGGCTCCTTCCCTGTCGCCCCGG - Intergenic
1111378906 13:87419903-87419925 CTTCCCCTTCGCTTTCCACCAGG - Intergenic
1112067509 13:95809564-95809586 CTACTCCTTCGCTGTCCCTTCGG + Intronic
1113824027 13:113236314-113236336 CTGCTGCTTCCCAGTCTCCCGGG - Intronic
1114670425 14:24408104-24408126 CTGCCCCTCTGCTGACCCCCCGG + Exonic
1117663050 14:58028476-58028498 GTGCTCCTTTGATGTTCCCCTGG + Intronic
1118233394 14:63975914-63975936 CTGCTACCTGGATGTCCCCCCGG - Intronic
1118315404 14:64722891-64722913 CTGCTCCTCCCCTATCCCACAGG - Intronic
1118769000 14:68929278-68929300 CTGCTCCTTAGCAGTGCTCCAGG + Intronic
1119236888 14:73027041-73027063 CTCCTCCTTCGTTGCCTCCCGGG + Exonic
1119622719 14:76144834-76144856 CTGCTCCTTGGCTGCTGCCCTGG + Intergenic
1121488932 14:94344015-94344037 CTGCTCCTTCCCTCCCCACCAGG + Intergenic
1122628736 14:103097821-103097843 CAGCTTCTTCTCTGTCCTCCCGG - Intergenic
1122629243 14:103099734-103099756 CAGCTCCTTCACTGCCCTCCAGG - Intergenic
1124233631 15:27968044-27968066 CTGCTCTTTCGCTGACGTCCTGG + Intronic
1125601137 15:40916334-40916356 CTGCTCCTTCTCTTTCCCCCTGG + Intergenic
1127641350 15:60918755-60918777 CTGCTCCCTCCCTGTCACCAAGG - Intronic
1128995512 15:72291585-72291607 TTCTTCCTTCGCTGTCACCCAGG - Intronic
1129832418 15:78679462-78679484 CTGCCCCTTCCCGGTCCCCCAGG - Intronic
1130517741 15:84639137-84639159 CTGCTCCCACCCTTTCCCCCTGG + Intergenic
1130560916 15:84958298-84958320 CTGCTGCTCAGCTGTCACCCTGG + Intergenic
1131207377 15:90461799-90461821 ATGCAGCTTCGCTGTCACCCAGG - Intronic
1132629403 16:909725-909747 CTCCTCCCACCCTGTCCCCCCGG - Intronic
1132638858 16:967836-967858 CTGCTTCCTCGCTGTCCACTGGG + Intronic
1132672791 16:1108573-1108595 CTGGTCCTGCGCTTTCTCCCGGG + Intergenic
1132725163 16:1335229-1335251 TTGCTCCCTGGCTGTCCCCCAGG - Intronic
1134351841 16:13444841-13444863 CTGCTCTTGCTCTGTCACCCAGG + Intergenic
1134503537 16:14787687-14787709 CTGCTCGTCCCCTGTCCCCTCGG - Intronic
1134577030 16:15341211-15341233 CTGCTCGTCCCCTGTCCCCTCGG + Intergenic
1134725409 16:16415280-16415302 CTGCTCGTCCCCTGTCCCCTCGG - Intergenic
1134942023 16:18296578-18296600 CTGCTCGTCCCCTGTCCCCTCGG + Intergenic
1135187556 16:20328381-20328403 CTGCTTCTTCTCTGTCACTCTGG + Intergenic
1136475900 16:30513232-30513254 CTGCCCAATCCCTGTCCCCCAGG - Intronic
1138497841 16:57419108-57419130 CGGCCCCATCGCTGTCCCCAGGG + Intergenic
1139670819 16:68491664-68491686 CCTCTTCTTCGCTGCCCCCCTGG - Intergenic
1140528760 16:75646610-75646632 CTTCTCCATCGCTTTCCCCAAGG - Intronic
1140653823 16:77118857-77118879 CTTCCCCTTCCCTCTCCCCCAGG - Intergenic
1141054473 16:80803599-80803621 CTCCCCCTTCGCAGCCCCCCGGG + Intronic
1143569458 17:7746270-7746292 CTGCTCCTCTGCTGTCCCCTAGG + Intronic
1144065590 17:11621437-11621459 TTGTTCCTTCCCTGTCCCTCTGG - Intronic
1144074964 17:11709064-11709086 CTGGGCCTTCGCAGTCGCCCAGG + Intronic
1144511759 17:15882947-15882969 CTGTTCCCTCTCCGTCCCCCAGG + Intergenic
1145123209 17:20279093-20279115 CTGTTCCTTCTCCATCCCCCAGG + Intronic
1145752028 17:27361918-27361940 CTGATCCTGCTCTGTCCCCATGG + Intergenic
1147428238 17:40356352-40356374 CTCCTCCCTCCCCGTCCCCCAGG - Exonic
1147868992 17:43574122-43574144 CTGCAGCTTCGCTGGGCCCCTGG + Intronic
1148710489 17:49677571-49677593 CTGCTTCTTCGCTGCCCCGGGGG - Intronic
1148914300 17:50961507-50961529 GTGCTCCTGCCCTGTTCCCCAGG + Intergenic
1149548598 17:57522839-57522861 CTGCTCTTTAGCTGTCTCCTGGG + Intronic
1150502914 17:65668316-65668338 CTGCTCCTTCACTAATCCCCAGG + Intronic
1150562234 17:66303363-66303385 CTCCTCCTCCCCTGTCCCCTGGG - Intronic
1152520347 17:80852604-80852626 CTGCTCTTTCTCTGCCCCCAAGG + Intronic
1153345103 18:4017218-4017240 CTCCTCCTTCTCTCTCCCTCAGG + Intronic
1153463576 18:5364125-5364147 CTCATCCTCCGCCGTCCCCCAGG - Intergenic
1153753425 18:8257003-8257025 CTGCTTCTCCGCTGTCCCCTGGG + Intronic
1153837962 18:8981258-8981280 CTGCTCCTAGGCTGTCTCCAAGG - Intergenic
1153977823 18:10284941-10284963 CTGCTCCCCAGCTGTCCCTCAGG - Intergenic
1154486870 18:14879026-14879048 CTGCACCCTCGCGGTGCCCCCGG - Intergenic
1156214437 18:34981350-34981372 CATCTCCCTCTCTGTCCCCCAGG - Intronic
1157519635 18:48336758-48336780 CTGCCCCTACCCAGTCCCCCAGG + Intronic
1157694369 18:49708983-49709005 CAGCTCCTTAGCTGTCCCCTTGG - Intergenic
1159969848 18:74635787-74635809 CTGCTCATTGGCTTTCCACCCGG + Intronic
1161288540 19:3480654-3480676 CTGCCCCATCGCTCTCCCTCCGG + Intergenic
1161375681 19:3937994-3938016 CTCCCCCTCCACTGTCCCCCCGG + Intronic
1163508734 19:17723083-17723105 CTGACCCTGCTCTGTCCCCCAGG - Intronic
1163547440 19:17948407-17948429 CTACTCCCCCGCCGTCCCCCCGG - Intergenic
1163598305 19:18233161-18233183 CTGCCCCTTCGCCGACCCCCAGG + Exonic
1163889338 19:19997139-19997161 CTGCTCATTCTCTGTGCCCCTGG - Intronic
1164146262 19:22514377-22514399 CTGCTCCATCGCTGTCCACTAGG - Intronic
1164160096 19:22620687-22620709 CTGCTCCATCGCTGTCCACTAGG + Intergenic
1164827367 19:31293546-31293568 CTGCTCATTCCATGTCCCCCAGG + Intronic
1166323971 19:42037873-42037895 CTGGGCCTTAGCTGTCCCACAGG - Intronic
1166424443 19:42663166-42663188 CTGCCCCTTCCCTGCCCCCAAGG - Intronic
1167454115 19:49589879-49589901 CTGTACCTTTGCTGTCCCCAGGG + Exonic
1167762478 19:51458228-51458250 CTGCTCCTTCTCCTACCCCCAGG - Exonic
925274517 2:2639313-2639335 CTGCTCCTCCCATGACCCCCTGG - Intergenic
925336762 2:3104428-3104450 CCGCTCCGTGGCTGTCACCCTGG - Intergenic
926271535 2:11370581-11370603 CTTCTCCTGCTCTGTCTCCCAGG - Intergenic
926307181 2:11646764-11646786 CTACTCCTTCCCTCTGCCCCTGG - Intergenic
927497370 2:23559894-23559916 CTGCTCCTTCTCAGTCTCCTTGG - Intronic
929385512 2:41401922-41401944 CTGCTCCTGTACTCTCCCCCTGG + Intergenic
929880430 2:45832259-45832281 ATGCTCCTTCATTGTCCTCCTGG - Intronic
930872649 2:56184294-56184316 CAGCTCCCCCGCTGTCCCCGAGG + Exonic
932601444 2:73129338-73129360 CTCATCCTCCGCTATCCCCCAGG + Intronic
932767894 2:74482748-74482770 CTGCTCCTCCCCAGTGCCCCCGG + Exonic
933784849 2:85830425-85830447 CCTCTCCTTAGCTGCCCCCCTGG + Intergenic
934553806 2:95277173-95277195 CTTCCCCATCGCTGTACCCCAGG + Intronic
934756220 2:96826714-96826736 CTGCTCCATCGAGGACCCCCTGG + Intronic
934902035 2:98167131-98167153 CCGCCCCTTCCCTGTCCCGCTGG - Intronic
936141871 2:109947898-109947920 CTGCCCCTTCGTTGCCCTCCTGG + Intergenic
936178559 2:110245846-110245868 CTGCCCCTTCGTTGCCCTCCTGG + Intergenic
936202819 2:110423586-110423608 CTGCCCCTTCGTTGCCCTCCTGG - Intronic
937110969 2:119367008-119367030 CGCCTCCTCCGCTGTCTCCCTGG + Exonic
938119179 2:128621986-128622008 CTTATCCTTCACCGTCCCCCAGG + Intergenic
938308319 2:130269007-130269029 CTGCTCCTCAGTTGTCCCCAAGG - Intergenic
938447010 2:131387829-131387851 CTGCTCCTCAGTTGTCCCCAAGG + Intergenic
941650266 2:168084981-168085003 CTGCCCCTTAGCTGTCTCACAGG + Intronic
942125740 2:172823320-172823342 CTTCTCCTTTGCTGGGCCCCTGG + Intronic
944457653 2:199911698-199911720 CTCCTCCTTCGCTGGGTCCCCGG - Exonic
947102299 2:226634125-226634147 TTGCTCCTTCACAGTCCTCCTGG + Intergenic
947849549 2:233274688-233274710 CTCTTCCTTCCCAGTCCCCCAGG + Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948916863 2:241038897-241038919 CTGCTCCTCGGCTATGCCCCAGG + Intronic
1169033744 20:2432983-2433005 CTGCCACCTCGCTGTCACCCTGG + Intergenic
1169275166 20:4228848-4228870 CTGCCCCTTTGCTGGCTCCCTGG + Intronic
1170059687 20:12246070-12246092 CTGAACCTTCGCTGTTGCCCAGG + Intergenic
1170674521 20:18467006-18467028 CTCCTCCTTCGCCGCCGCCCGGG + Exonic
1171470739 20:25369090-25369112 GTGGTCCTTCTCTGTCACCCAGG - Intronic
1171503125 20:25610159-25610181 CTGCTCCTTTCCTCTCCTCCAGG - Intergenic
1171959953 20:31486078-31486100 CAGCTCCTGCACTGTCTCCCTGG - Intergenic
1172320743 20:33993759-33993781 CTCCTCCTTCTCTGTCTCCTGGG - Exonic
1172409664 20:34711678-34711700 CTGCCCCTTCTGTCTCCCCCAGG - Exonic
1172447460 20:35000704-35000726 CTGCACCTGCTCTGTCCCCAGGG - Intronic
1174805297 20:53599814-53599836 CTGCTCCCTCCCAGTCCCCTTGG + Intronic
1175304097 20:57964248-57964270 TTGCTTCTTCCCTGTCCCCCAGG + Intergenic
1175758868 20:61547696-61547718 CTGCTCCTGCGCTGTCTGCAGGG - Intronic
1175861009 20:62150275-62150297 CTGCTCCGTCCCTGCCCCCGAGG - Intronic
1176343573 21:5720474-5720496 CTGCTCATTCTCTGTGCCCCTGG - Intergenic
1176501254 21:7603982-7604004 CTGCTCATTCTCTGTGCCCCTGG + Intergenic
1176537894 21:8118543-8118565 CTGCTCATTCTCTGTGCCCCTGG - Intergenic
1176603812 21:8813988-8814010 CAGCCCCTGCGCTGGCCCCCTGG - Intergenic
1176794416 21:13360308-13360330 CTGCACCCTCGCGGTGCCCCCGG + Intergenic
1179397620 21:41056110-41056132 CTGCTTCTGAGCTGTGCCCCTGG - Intergenic
1179940996 21:44638818-44638840 CAGCTCCATGGCTGCCCCCCAGG + Intronic
1179970705 21:44835720-44835742 CTGCTCCTTCCAAGGCCCCCTGG + Intergenic
1180346097 22:11705565-11705587 CAGCCCCTGCGCTGGCCCCCTGG - Intergenic
1180593920 22:16961682-16961704 CTTCTCCCTGGCTGTCTCCCCGG + Intergenic
1181016434 22:20071771-20071793 CCGTTCCTACACTGTCCCCCAGG - Intergenic
1181464287 22:23102446-23102468 CTGCTCCTTTCCTGTCACACTGG + Intronic
1182313557 22:29426883-29426905 CTCCTCTCTCGATGTCCCCCTGG - Intergenic
1183651313 22:39155504-39155526 CTGCTCTTCCGCTGTCGCCGTGG + Intergenic
1183784842 22:40023364-40023386 CTGCTCCTGCTCTGTACCTCTGG + Intronic
1184487953 22:44792488-44792510 CTGGTCCTGAACTGTCCCCCTGG - Intronic
1185085819 22:48740488-48740510 CAGCTCCATCCCTGCCCCCCTGG - Intronic
1185129100 22:49027536-49027558 CTGCCCCTTCACTGTCCTGCCGG + Intergenic
1185134685 22:49062961-49062983 CTGGTCATTCCCTTTCCCCCAGG - Intergenic
1203242841 22_KI270733v1_random:34898-34920 CTGCTCATTCTCTGTGCCCCTGG - Intergenic
949475222 3:4438470-4438492 CTCATCCTTCCCAGTCCCCCAGG + Intronic
950005629 3:9689304-9689326 CAGCTGCTTCTCTGTCCCACAGG - Intronic
950068651 3:10134548-10134570 GTGCTCCTGCTCTGTCACCCAGG - Intergenic
951317921 3:21208737-21208759 CTGATCTTGCTCTGTCCCCCAGG - Intergenic
953256576 3:41296656-41296678 CTGCTCATTTGCTCTTCCCCTGG - Intronic
953288094 3:41632899-41632921 CTGCTCCTTTGCTGAACCTCAGG - Intronic
954186251 3:48919086-48919108 CTCCGCCTTCGCCGTCGCCCGGG + Exonic
955341680 3:58130015-58130037 CTGCTACATGGCTGACCCCCCGG - Intronic
955978095 3:64497520-64497542 CTGCTCCTTGACTCTCCCCCCGG + Intergenic
956973161 3:74550562-74550584 CAGCTCTTTCTCTGTCACCCAGG + Intergenic
957107301 3:75906908-75906930 GGGCTGCTTCCCTGTCCCCCTGG + Exonic
960961415 3:123072983-123073005 CTGCTCCTTCCCTCTCCCGTTGG - Intronic
961203610 3:125063340-125063362 CTGCTCCTTCCCTGGGGCCCTGG - Intergenic
961782495 3:129328844-129328866 CTGCTCCTGCCCTGTCCCACAGG + Intergenic
962009778 3:131381773-131381795 CTGCTCCTCTGCTGTCCCGAAGG - Exonic
962014323 3:131424670-131424692 CTGCTCCTTGGCCATCCCTCTGG - Intergenic
962089833 3:132231309-132231331 CTATTCCTTCGCTTTCCCCAGGG + Intronic
964810026 3:160653558-160653580 CTGGCCCTCTGCTGTCCCCCAGG - Intergenic
966176341 3:177142290-177142312 CTGCTCCTGAGCTGGCCCTCTGG - Intronic
967102550 3:186228291-186228313 CTCTTCCTTCTCTCTCCCCCTGG + Intronic
967380801 3:188855633-188855655 GAGCTCCTTCTCTGTGCCCCAGG + Intronic
968025806 3:195442244-195442266 CTTCTGCTTCGCGGTGCCCCCGG - Intronic
968849231 4:3067266-3067288 CTTCTCCTTCTCTCTCTCCCTGG - Intergenic
976388070 4:84482861-84482883 CTGCGCCTCCGCTGACCCCGGGG - Intergenic
978387432 4:108190251-108190273 CTGCTCCTTCTCCGTCTCCCTGG + Intergenic
979225729 4:118282079-118282101 GTGGTCCTCCGCTGTCTCCCTGG + Exonic
980025823 4:127765218-127765240 CTGCTCCTTTGCTTTCATCCTGG + Intronic
981340125 4:143612238-143612260 CATCTCCTTCCCTGTCTCCCAGG + Intronic
982326536 4:154135024-154135046 CTGCTACATTGCTGTCTCCCAGG - Intergenic
982658442 4:158177551-158177573 CTGCTCCATCTCTGTCCCCAGGG + Intergenic
983464852 4:168074450-168074472 CTGGTCTTTCTCTGTCACCCAGG - Intergenic
984001150 4:174246763-174246785 GTGCTACTGTGCTGTCCCCCAGG - Intronic
986338243 5:6770352-6770374 GTGCTGCTTCCCTGTCCCCAGGG + Intergenic
986845196 5:11744278-11744300 CTGCTCCTGAGCTCTGCCCCAGG + Intronic
987131188 5:14861618-14861640 CAGCCCCTCCTCTGTCCCCCAGG + Intronic
988553260 5:32215886-32215908 CTGCTCCTTCTCGGCCTCCCTGG - Intergenic
989169058 5:38457399-38457421 CGGCTCCATGCCTGTCCCCCAGG + Intronic
991456946 5:66814115-66814137 CTGTTCCTTCTCTCTCCCCTGGG + Intronic
992004149 5:72461274-72461296 CTGCTCCTTCGAAGACCCCGGGG + Exonic
992399948 5:76403145-76403167 CGGCCCCTTCCCTCTCCCCCGGG + Intergenic
995688618 5:114798867-114798889 CTGATCCTTCTCTGTTTCCCAGG + Intergenic
997368637 5:133341946-133341968 CTGCTCCAGCACTGTCTCCCAGG + Intronic
998388640 5:141772943-141772965 CTGCTCCTAGCCTGTCTCCCCGG + Intergenic
1000351254 5:160354768-160354790 CTTCCTCTCCGCTGTCCCCCCGG + Exonic
1001037776 5:168310027-168310049 CTCCCCCTTCCCTGTCCCCTTGG + Intronic
1001438956 5:171723544-171723566 TTGCTCTGTCGCTGTCGCCCAGG + Intergenic
1002038163 5:176489561-176489583 TTGCTCTGTCGCTGTCACCCAGG + Intronic
1002058810 5:176614027-176614049 CAGCTCCTTGGCTGGCGCCCAGG + Intergenic
1002180283 5:177427630-177427652 CTGGTCCTTCTGTGTCTCCCAGG - Intronic
1002629988 5:180566683-180566705 AGGCTCTTTCTCTGTCCCCCAGG + Intronic
1002763292 6:218229-218251 CTGCCCCCTGGCTGTCCCCGGGG - Intergenic
1003905929 6:10699616-10699638 CTCCTCATTCTCTGTCCCCTGGG - Intronic
1004864393 6:19838322-19838344 CTGCTCCTCCGGGCTCCCCCGGG + Intronic
1004936559 6:20513681-20513703 TTGCTCTGTCGCTGTCGCCCAGG - Intergenic
1005258153 6:24026950-24026972 CTGCTCCTTCCCCTTCCCTCAGG + Intergenic
1005847222 6:29791763-29791785 CTACTCCTTACCTGTCCCCGTGG - Intergenic
1006558530 6:34889395-34889417 CTGCTCCTTCCCCATCCCCAGGG - Exonic
1007817055 6:44531879-44531901 CTCCTCCTTCCCTGCCCACCTGG + Intergenic
1011925497 6:92639160-92639182 CTGTTCCTTAGCAGGCCCCCTGG + Intergenic
1012697126 6:102399823-102399845 CTGTTCCTTAGCTTTCACCCTGG + Intergenic
1015783240 6:136893359-136893381 CTGCTCTTCTGCTGTCTCCCTGG + Intronic
1016995661 6:149960923-149960945 CTTCTCCTTCTCTTTCCTCCTGG + Intergenic
1017162708 6:151380839-151380861 CTTCTCCTTGGCTGTCCCCCAGG + Intronic
1017770051 6:157638070-157638092 CTCCTCCCTCCCTCTCCCCCTGG - Intronic
1018926784 6:168212423-168212445 CTGCTGCCCCGCTGCCCCCCTGG - Intergenic
1019287539 7:231238-231260 CTGCTCCTGCTCTGCCCTCCAGG - Intronic
1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG + Intronic
1019493557 7:1325924-1325946 CTGCTCCTCTGCTGTCCCTGAGG + Intergenic
1019854470 7:3590806-3590828 CTGGTCTTGCTCTGTCCCCCAGG + Intronic
1020188218 7:5974641-5974663 CTGCTCCTTCCCTCTCGCCCTGG - Intronic
1020294699 7:6750127-6750149 CTGCTCCTTCCCTCTCGCCCTGG + Intergenic
1022101018 7:27169256-27169278 CTGCTCCTTCGCGGACGCCGGGG - Intronic
1023244640 7:38188259-38188281 CTGCAGCTTCGCTGGCCACCTGG + Intronic
1023834324 7:44059477-44059499 CTTCTCCACTGCTGTCCCCCAGG - Intronic
1024082394 7:45865994-45866016 CTGCCCCATCCCTTTCCCCCAGG - Intergenic
1024176567 7:46846389-46846411 CTGCCCCCTCTCTCTCCCCCAGG + Intergenic
1024295271 7:47836768-47836790 CTGTTCCTTCTCTGGTCCCCAGG + Intronic
1025263534 7:57438414-57438436 CTGCTCCTTACATGTGCCCCAGG + Intergenic
1025740652 7:64192972-64192994 CTGCTCCTTACATGTGCCCCAGG + Intronic
1025812731 7:64885396-64885418 CTGCCCCTTCACTGTCTGCCTGG + Intronic
1027916815 7:84334833-84334855 CTGCTCCCTGGCTCTTCCCCTGG + Intronic
1028317698 7:89424231-89424253 TTGCTCTTTCTCTGTCACCCAGG + Intergenic
1029223137 7:99005926-99005948 CTGCTGCCTCGCTGGCGCCCAGG - Intronic
1029268779 7:99363699-99363721 AGGCTCCTTCTCTGTCACCCAGG + Intronic
1029421741 7:100475649-100475671 CTGCTCCTGCGCTCTGCCCTAGG + Intronic
1032494913 7:132354075-132354097 TTGCTCCTTTGATGTCCCCTTGG - Intronic
1034081326 7:148280230-148280252 CTGCAACTTCTCTGTCTCCCGGG - Intronic
1034215025 7:149398592-149398614 CTGCTGCTTTGCTGTCCCTGGGG + Intergenic
1035004493 7:155644888-155644910 CTGCTCCTCCGCTCGCTCCCAGG - Exonic
1036621100 8:10424903-10424925 CTGCTCCTTCGCTGTCCCCCGGG - Intronic
1037918651 8:22788303-22788325 CTGCTCCTTCTTTGTCCCCCTGG - Intronic
1038134033 8:24766616-24766638 CTGCTTCTTTGCTGTCTCCCAGG - Intergenic
1040030079 8:42815880-42815902 CAGCTCCTTCTCAGTCCTCCTGG - Intergenic
1040462277 8:47660521-47660543 CTGCTGCTACCCTGTTCCCCTGG + Intronic
1040559928 8:48514834-48514856 CGGCTCCTTGGCTGGCCCGCGGG - Intergenic
1047432776 8:124807067-124807089 CTGCTGCTTCCCTCTGCCCCTGG + Intergenic
1048017051 8:130506842-130506864 CTGCTTCTTCGGTTTCCCCAAGG - Intergenic
1048302215 8:133260153-133260175 CTGTTTCTTCCCTGTTCCCCAGG + Intronic
1048430623 8:134367230-134367252 CTTCTCCTTCACTGTCTCCCAGG + Intergenic
1048546099 8:135388660-135388682 CTTCTCCTCCTCTATCCCCCAGG - Intergenic
1048546748 8:135394736-135394758 CTGCTCCTTTCCTGTTGCCCAGG + Intergenic
1048868150 8:138776010-138776032 CTGCTCTTTCTTTGTCCCCCAGG - Exonic
1048873265 8:138816151-138816173 CTTCTCCTTCCCTGTCCCTGCGG - Intronic
1049310998 8:141933799-141933821 TTGCTCCTTCCCTGACACCCTGG - Intergenic
1049639499 8:143708319-143708341 CTGGACCTTCGCTGTCCGTCTGG + Intronic
1049752530 8:144291901-144291923 CTGCTCCCTCCCGGTCCCCACGG - Intronic
1049815722 8:144598395-144598417 CTGCTCCTTCCCAGCCTCCCTGG - Intronic
1049861902 8:144904534-144904556 CAGCTCCTTCACTGTCTACCTGG + Intergenic
1050090854 9:2015894-2015916 ATCCTCCTCCCCTGTCCCCCAGG - Intronic
1053434300 9:38065368-38065390 CTTCTCCTTAACTGTCCCTCTGG - Intronic
1055787327 9:79884634-79884656 CTACTCCCTCTGTGTCCCCCTGG - Intergenic
1057361271 9:94375330-94375352 CTGCTCCTTCCGTGTTCTCCCGG + Intronic
1057448651 9:95137338-95137360 CAGCTCCTCCGCAGTCTCCCCGG - Intronic
1057599648 9:96446574-96446596 CTCCTCCTTGGCTCTCACCCAGG + Intergenic
1057662094 9:97012839-97012861 CTGCTCCTTCCGTGTTCTCCCGG - Intronic
1057699175 9:97350343-97350365 CTGCCCCTCCCTTGTCCCCCAGG + Intronic
1058910644 9:109517320-109517342 CTGATCCTTTGAGGTCCCCCAGG + Intergenic
1059282801 9:113149271-113149293 GCACTCCTTCCCTGTCCCCCAGG - Intergenic
1060995209 9:127871939-127871961 TTCCTCCTTTGCTGTGCCCCAGG - Exonic
1062119109 9:134824578-134824600 CTGCTCCTGTTCTGTCCCCCAGG + Exonic
1062172731 9:135144507-135144529 CGGCTCATTCCCTGTCCCCCAGG + Intergenic
1062237363 9:135516714-135516736 CAGCTCCTCCTCTGTCCCCGGGG - Intergenic
1062285745 9:135771788-135771810 CTGCTCCCTAACTGTCCCCCAGG - Intronic
1062648771 9:137564839-137564861 CGTCTCTTTCGCTGTCCCCGGGG - Intronic
1203459167 Un_GL000220v1:17981-18003 CTGCTCATTCTCTGTGCCCCTGG - Intergenic
1187460110 X:19478934-19478956 AAGCACCTTCTCTGTCCCCCAGG - Intronic
1189332973 X:40154381-40154403 CTGCTCGCTCGCTCTCGCCCAGG + Intronic
1191937091 X:66437759-66437781 CTCCTCCTTCGCCCTTCCCCAGG + Intergenic
1195129484 X:101839409-101839431 CTGCTCCCTGGCTGGCCCCGGGG + Intronic
1197062748 X:122200639-122200661 CTGGTCTTTCTCTGTCACCCAGG - Intergenic
1197133316 X:123031359-123031381 CTGCTCCTTCTCTGTCTCCTTGG + Intergenic