ID: 1036621564

View in Genome Browser
Species Human (GRCh38)
Location 8:10427581-10427603
Sequence GAGTGTCCCCTCACTCGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036621564_1036621568 -4 Left 1036621564 8:10427581-10427603 CCACAGCGAGTGAGGGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1036621568 8:10427600-10427622 ACTCTGTCTATCCTGGGAGTGGG No data
1036621564_1036621574 22 Left 1036621564 8:10427581-10427603 CCACAGCGAGTGAGGGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1036621574 8:10427626-10427648 GGGTCCTGTTCCTGAGCTGGTGG No data
1036621564_1036621575 23 Left 1036621564 8:10427581-10427603 CCACAGCGAGTGAGGGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1036621575 8:10427627-10427649 GGTCCTGTTCCTGAGCTGGTGGG No data
1036621564_1036621569 0 Left 1036621564 8:10427581-10427603 CCACAGCGAGTGAGGGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1036621569 8:10427604-10427626 TGTCTATCCTGGGAGTGGGCTGG No data
1036621564_1036621573 19 Left 1036621564 8:10427581-10427603 CCACAGCGAGTGAGGGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1036621573 8:10427623-10427645 CTGGGGTCCTGTTCCTGAGCTGG No data
1036621564_1036621571 2 Left 1036621564 8:10427581-10427603 CCACAGCGAGTGAGGGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1036621571 8:10427606-10427628 TCTATCCTGGGAGTGGGCTGGGG No data
1036621564_1036621566 -10 Left 1036621564 8:10427581-10427603 CCACAGCGAGTGAGGGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1036621566 8:10427594-10427616 GGGGACACTCTGTCTATCCTGGG No data
1036621564_1036621570 1 Left 1036621564 8:10427581-10427603 CCACAGCGAGTGAGGGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1036621570 8:10427605-10427627 GTCTATCCTGGGAGTGGGCTGGG No data
1036621564_1036621567 -5 Left 1036621564 8:10427581-10427603 CCACAGCGAGTGAGGGGACACTC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1036621567 8:10427599-10427621 CACTCTGTCTATCCTGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036621564 Original CRISPR GAGTGTCCCCTCACTCGCTG TGG (reversed) Intronic
901268058 1:7927519-7927541 GAGTGTGCCAGCACTTGCTGTGG - Intronic
902515548 1:16987675-16987697 CAGTGTCACCTCATTCGCTGGGG + Intronic
916063472 1:161118093-161118115 GAGTTACCGCCCACTCGCTGCGG + Exonic
916651177 1:166836074-166836096 GAGTGTTCCTTAACTCTCTGAGG + Intergenic
918332164 1:183471599-183471621 GGGTGTCCCCCCAGTTGCTGTGG + Intergenic
923373371 1:233335106-233335128 GACTGTCCCCAAACTCTCTGAGG + Intronic
1063443560 10:6093146-6093168 GAGTGTTGCCTCCCTCTCTGGGG + Intronic
1064032675 10:11893186-11893208 GAGTGTCCCCTCAGCCTCTCAGG + Intergenic
1065835992 10:29659021-29659043 GGGTTTCCCCTCACTCTTTGAGG - Intronic
1069124958 10:64618983-64619005 GAGCCTCCCCTCCCTCACTGTGG + Intergenic
1069610615 10:69770160-69770182 GAGTGTCCATTCTCTCTCTGGGG - Intergenic
1073343542 10:102764476-102764498 CTGTGTCACCTCACTCTCTGTGG + Intronic
1075970122 10:126644822-126644844 CAGTGTCCCCAAACTCCCTGTGG + Intronic
1077053489 11:578370-578392 GAGTCTTCCCTCACCAGCTGTGG + Intronic
1078460805 11:11514007-11514029 CAGGGTCCCCTCACTCCCAGTGG - Intronic
1084202780 11:67572937-67572959 GAGTGTTCTCTAACTCCCTGGGG - Intergenic
1108430470 13:50348125-50348147 GTGTATCCCCTTCCTCGCTGTGG - Intronic
1112365217 13:98750687-98750709 AAGTGTCCCCTCAGTCACTGAGG + Intronic
1114699844 14:24665700-24665722 GAGTTTCCTGTCACTGGCTGGGG + Intergenic
1122480598 14:102044739-102044761 GAGGGTCCCCTCACGCGGGGTGG + Intronic
1132055820 15:98649601-98649623 GAGGGTCCCCGACCTCGCTGTGG + Exonic
1132291879 15:100709575-100709597 GAGTTTCCCATAACTTGCTGGGG - Intergenic
1134314057 16:13102078-13102100 GACTGTCCCCTCCCTCCCTGAGG + Intronic
1141616501 16:85212733-85212755 GGGTGTCCGCCCACTCGCAGGGG + Intergenic
1142738589 17:1917418-1917440 GAGGCTCCCTACACTCGCTGGGG - Intergenic
1143103133 17:4514898-4514920 GTGTGGCCCCTGACTCACTGGGG + Intronic
1147960946 17:44167292-44167314 GGGTGTCCCCTTCCTCCCTGAGG - Intergenic
1156498942 18:37544829-37544851 GAGTATCCCCTAACTTTCTGTGG - Intronic
1163256895 19:16161408-16161430 GGGTGACCCCTCACCCGCTGTGG - Exonic
1165484325 19:36086305-36086327 CAGTGTCCTCTCACCCTCTGAGG - Intronic
925113820 2:1360540-1360562 GAGCTTCCCCTCACTTGTTGTGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
929592760 2:43157845-43157867 GAGTGTCCCCCCACAACCTGAGG + Intergenic
935402657 2:102676294-102676316 GAGTGTCCCCATTCTAGCTGGGG - Intronic
1174196482 20:48776130-48776152 GAGACTCCCCTCACCCCCTGAGG + Intronic
1176904165 21:14479591-14479613 GAAAGTCCCCTCATTCCCTGAGG - Intergenic
1182283242 22:29229917-29229939 AAGTGTCCCCTCAGCTGCTGAGG - Intronic
1182618325 22:31603688-31603710 GAGGGTGCCCTCACTGGGTGGGG + Intronic
1184725443 22:46342367-46342389 GAGTGTCCACACCCTCCCTGGGG + Intronic
950433113 3:12962640-12962662 GACTGTCCCCTAACTCACTGAGG - Intronic
951881220 3:27483532-27483554 GAGTGTCCCCTCCCGCTCCGCGG - Intronic
954414895 3:50388495-50388517 CAGTGGCCCCTCACTCACTCAGG + Intronic
962794026 3:138835185-138835207 GAGAGACCCATCACCCGCTGCGG + Intergenic
964959187 3:162403308-162403330 GAGTGTCCCCACTCCCACTGAGG - Intergenic
965139239 3:164814325-164814347 CAGTGGCCCCACACTCGGTGTGG + Intergenic
968230988 3:197004273-197004295 TAGTGTCCCCACACCCGCTTGGG - Intronic
969560248 4:7942161-7942183 GAATGTCCTTTCACTCCCTGAGG - Intergenic
969940649 4:10727640-10727662 GACTGTCCCCTCACCCTTTGGGG - Intergenic
983793110 4:171823330-171823352 GACTGTCCCCTCAATCTCTCAGG - Intronic
989115784 5:37951215-37951237 GAGTTTCCACTAACTAGCTGTGG + Intergenic
992009142 5:72509645-72509667 GAGAGTCCCCTGGCTGGCTGCGG - Intergenic
1001818713 5:174693083-174693105 GAGTGACCCCTAACTGGCAGAGG - Intergenic
1002778947 6:352032-352054 GAGTGTCCCCTCACGCTCATCGG - Intergenic
1004172323 6:13305238-13305260 GTGTCTTCCCTCATTCGCTGTGG + Intronic
1010016522 6:71110688-71110710 GACTGTACCCTTACTCTCTGGGG + Intergenic
1018707967 6:166476647-166476669 GAGGGTCCCCTCTCTCCCTGGGG + Intronic
1023540895 7:41264778-41264800 GAGAGTTCCCACACTGGCTGTGG - Intergenic
1029692186 7:102189888-102189910 CTGTGGCCCCTCACACGCTGGGG + Intronic
1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG + Intronic
1036621564 8:10427581-10427603 GAGTGTCCCCTCACTCGCTGTGG - Intronic
1038939179 8:32284887-32284909 GAGCTTCCCGTCACTCTCTGGGG + Intronic
1045881730 8:107048655-107048677 GAGTGTTAGCTCACTCTCTGAGG - Intergenic
1047292218 8:123540885-123540907 GCGGGTCCCCTCACCTGCTGAGG + Exonic
1049155219 8:141062127-141062149 GCTTGTCCCCTCACTCCCTGGGG + Intergenic
1049698371 8:143994650-143994672 GTGTGTCCCCACACTGGCAGAGG - Intronic
1050032634 9:1402446-1402468 GAGTGTGCCTTCTCTCTCTGTGG + Intergenic
1052372082 9:27676373-27676395 GAGGGTCCCCTTCCACGCTGTGG + Intergenic
1061029077 9:128068693-128068715 GGGTGCCCCCTGACTCACTGAGG + Intronic
1190090573 X:47433700-47433722 GAGTCTCCCCTCTGTCGCTCAGG + Intergenic
1190223457 X:48528183-48528205 AAGTGTCCCCTTCCTCACTGGGG + Intronic