ID: 1036623347

View in Genome Browser
Species Human (GRCh38)
Location 8:10443862-10443884
Sequence CAGGGTGGCCAGAGAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036623341_1036623347 8 Left 1036623341 8:10443831-10443853 CCTAATGGATTGGCAAGAGAAAA No data
Right 1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG No data
1036623339_1036623347 10 Left 1036623339 8:10443829-10443851 CCCCTAATGGATTGGCAAGAGAA No data
Right 1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG No data
1036623340_1036623347 9 Left 1036623340 8:10443830-10443852 CCCTAATGGATTGGCAAGAGAAA No data
Right 1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036623347 Original CRISPR CAGGGTGGCCAGAGAGAGAA AGG Intergenic
No off target data available for this crispr