ID: 1036628584

View in Genome Browser
Species Human (GRCh38)
Location 8:10494029-10494051
Sequence GTTCCCAGTAGTCCAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036628583_1036628584 -8 Left 1036628583 8:10494014-10494036 CCTGTATTTCATGTTGTTCCCAG No data
Right 1036628584 8:10494029-10494051 GTTCCCAGTAGTCCAAGAGATGG No data
1036628582_1036628584 16 Left 1036628582 8:10493990-10494012 CCGTTAAACTTCAAAGAGGGAAG No data
Right 1036628584 8:10494029-10494051 GTTCCCAGTAGTCCAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036628584 Original CRISPR GTTCCCAGTAGTCCAAGAGA TGG Intergenic
No off target data available for this crispr