ID: 1036628999

View in Genome Browser
Species Human (GRCh38)
Location 8:10497191-10497213
Sequence AGGAACTGACCACAATGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036628990_1036628999 29 Left 1036628990 8:10497139-10497161 CCAAATGGAGAACCCAAAAAGAA No data
Right 1036628999 8:10497191-10497213 AGGAACTGACCACAATGCCAGGG No data
1036628993_1036628999 16 Left 1036628993 8:10497152-10497174 CCAAAAAGAAGACACATCTGGTC No data
Right 1036628999 8:10497191-10497213 AGGAACTGACCACAATGCCAGGG No data
1036628996_1036628999 -10 Left 1036628996 8:10497178-10497200 CCACCTTGTAGGAAGGAACTGAC No data
Right 1036628999 8:10497191-10497213 AGGAACTGACCACAATGCCAGGG No data
1036628989_1036628999 30 Left 1036628989 8:10497138-10497160 CCCAAATGGAGAACCCAAAAAGA No data
Right 1036628999 8:10497191-10497213 AGGAACTGACCACAATGCCAGGG No data
1036628992_1036628999 17 Left 1036628992 8:10497151-10497173 CCCAAAAAGAAGACACATCTGGT No data
Right 1036628999 8:10497191-10497213 AGGAACTGACCACAATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036628999 Original CRISPR AGGAACTGACCACAATGCCA GGG Intergenic
No off target data available for this crispr