ID: 1036629215

View in Genome Browser
Species Human (GRCh38)
Location 8:10498744-10498766
Sequence CATGGTTACCATTTCATGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036629215_1036629218 -4 Left 1036629215 8:10498744-10498766 CCGTTCATGAAATGGTAACCATG No data
Right 1036629218 8:10498763-10498785 CATGACGAGTTTGGAAAAGCAGG No data
1036629215_1036629219 3 Left 1036629215 8:10498744-10498766 CCGTTCATGAAATGGTAACCATG No data
Right 1036629219 8:10498770-10498792 AGTTTGGAAAAGCAGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036629215 Original CRISPR CATGGTTACCATTTCATGAA CGG (reversed) Intergenic
No off target data available for this crispr