ID: 1036629278

View in Genome Browser
Species Human (GRCh38)
Location 8:10499246-10499268
Sequence AGAGGCTCCCCTGCCAAGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036629278_1036629290 18 Left 1036629278 8:10499246-10499268 CCGAACTTGGCAGGGGAGCCTCT No data
Right 1036629290 8:10499287-10499309 GACTCACAACACATTGAAGAAGG No data
1036629278_1036629281 -5 Left 1036629278 8:10499246-10499268 CCGAACTTGGCAGGGGAGCCTCT No data
Right 1036629281 8:10499264-10499286 CCTCTCCCCCTCCCCAGGAGTGG No data
1036629278_1036629279 -10 Left 1036629278 8:10499246-10499268 CCGAACTTGGCAGGGGAGCCTCT No data
Right 1036629279 8:10499259-10499281 GGGAGCCTCTCCCCCTCCCCAGG No data
1036629278_1036629282 -4 Left 1036629278 8:10499246-10499268 CCGAACTTGGCAGGGGAGCCTCT No data
Right 1036629282 8:10499265-10499287 CTCTCCCCCTCCCCAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036629278 Original CRISPR AGAGGCTCCCCTGCCAAGTT CGG (reversed) Intergenic
No off target data available for this crispr