ID: 1036629281

View in Genome Browser
Species Human (GRCh38)
Location 8:10499264-10499286
Sequence CCTCTCCCCCTCCCCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036629278_1036629281 -5 Left 1036629278 8:10499246-10499268 CCGAACTTGGCAGGGGAGCCTCT No data
Right 1036629281 8:10499264-10499286 CCTCTCCCCCTCCCCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036629281 Original CRISPR CCTCTCCCCCTCCCCAGGAG TGG Intergenic
No off target data available for this crispr