ID: 1036630620

View in Genome Browser
Species Human (GRCh38)
Location 8:10511700-10511722
Sequence CTTCCCCCATACCTTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036630620_1036630626 6 Left 1036630620 8:10511700-10511722 CCCAGGGCAAGGTATGGGGGAAG No data
Right 1036630626 8:10511729-10511751 GGTGCTTCCATGCCCTCTCTGGG 0: 4
1: 35
2: 164
3: 365
4: 690
1036630620_1036630625 5 Left 1036630620 8:10511700-10511722 CCCAGGGCAAGGTATGGGGGAAG No data
Right 1036630625 8:10511728-10511750 TGGTGCTTCCATGCCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036630620 Original CRISPR CTTCCCCCATACCTTGCCCT GGG (reversed) Intergenic
No off target data available for this crispr