ID: 1036632118

View in Genome Browser
Species Human (GRCh38)
Location 8:10523301-10523323
Sequence ATGATGATATAGGTCGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036632118_1036632124 26 Left 1036632118 8:10523301-10523323 CCATATCCGACCTATATCATCAT No data
Right 1036632124 8:10523350-10523372 TCAAATTCCTTCTAGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036632118 Original CRISPR ATGATGATATAGGTCGGATA TGG (reversed) Intergenic
No off target data available for this crispr